F302319

General Info

Members Datasets Scaffolds Average Seq Length
196 163 141 743

Family's Representative Sequence

Representative Sequence iso_pu_bacteria|8002775197|8002776571
Length 867
Sequence RRRARRLGLVGTGATTPGATATPGATAATGTTAATGATAATGAIRRGHPRDGRRGVSRRLRPSRVPNPAERKTDRIMQPFVLPRFYVPYPARLSPHLESARAHSRAWAAEMGMIDAPDAGVTVWSERDFDAHDYALLCAYTHPDASADRLDLITDWYVWVFYFDDHFLELFKRTGDMAGAREYLDRLRAFMPLDDAGAGPETAGTDTAGLEAAGAAPVNAVERGLADLWARTVPDRSADWRRRFVASTRNLLDESLWELANINENRVSNPVEYVEMRRKVGGAPWSANLVEHAADAEVPAAIAARRPMRVLRDTFADAIHLRNDLFSYQREVEAEGELSNGVLVVERFLDCATQTAADLVNDLLTSRLHQFEHTALTEVPPLLDEHGIDPLARLAVLAYVKGLQDWQSGGHEWHLRSSRYMNDGPASAGLLPAGGSTAAPPVPVGDATAAASPRSAGAAALLAGPAGLGTSAARAVESIVVTAPRRLRAFSHVPFQVVRPPRDPEPYMPFPVRDNPHLTGTRRQTARWARAMGLLDPVPGIWDEHKLAAYDFPLCSAGLDPDATRDELDRSAQWLTWGTYADDYYPVVFGRARDLAGARACNERLRQFLPVEFDEERVAEAMPVPGIPLERALADLWARTAPRLGLAGRKAFRSAVSVMLDSWLWELGNHAANRIPDPIDYLEMRRLTFGSELTMTLARPSGEHGIPAEVYGTRPIRALENSAMDYAGLLNDIFSYQKEIQFEGELTNGVLVVENFLNCPRERAVRVVNDLMTARMRQFEHIVERELPALFDAYDLADEARGALLTYVDDLKNWLAGILRWHRRTRRYDEAELRQHPAAGVPPFGSATGLGTSAARLATVSRLARGG

Samples

Sample ID Description Type Environment
1 2527291627 Frankia casuarinae Thr Isolate Nodule
2 2527291629 Frankia sp. BMG5.23 Isolate Nodule
3 2546825537 Frankia sp. CcI6 Isolate Rhizoplane
4 2551306166 Nocardia tenerifensis NBRC 101015 Isolate Rhizosphere
5 2576861822 Frankia sp. CeD Isolate Nodule
6 2579778521 Frankia torreyi CpI1-S Isolate Unclassified
7 2585427649 Amycolatopsis japonica MG417-CF17, DSM 44213 Isolate Unclassified
8 2619618881 Frankia sp. ACN1ag Isolate Unclassified
9 2619619003 Frankia sp. CpI1-P Isolate Nodule
10 2626541554 Frankia sp. AvcI.1 Isolate Nodule
11 2671180195 Frankia sp. CcI49 Isolate Nodule
12 2675902999 Frankia asymbiotica NRRL B-16386 Isolate Nodule
13 2675903060 Nonomuraea wenchangensis CGMCC 4.5598 Isolate Rhizosphere
14 2684623035 Frankia sp. NRRL B-16219 Isolate Rhizosphere
15 2684623036 Frankia sp. CgIM4 Isolate Nodule
16 2687453743 Frankia colletiae Cc1.17 Isolate Nodule
17 2710264753 Frankia sp. KB5 Isolate Nodule
18 2751185734 Saccharothrix sp. NRRL B-16314 Isolate Rhizosphere
19 2773857921 Frankia asymbiotica NRRL B-16386 Isolate Nodule
20 2773857922 Frankia sp. CcI49 Isolate Nodule
21 2773857924 Frankia sp. CgIS1 Isolate Nodule
22 2773857933 Frankia sp. BMG5.30 Isolate Nodule
23 2775506925 Saccharopolyspora phatthalungensis NRRL B-24798 Isolate Rhizosphere
24 2795385470 Labedaea rhizosphaerae DSM 45361 Isolate Rhizosphere
25 2795385472 Herbihabitans rhizosphaerae DSM 101727 Isolate Rhizosphere
26 2808606522 Amycolatopsis sp. BJA-103 Isolate Unclassified
27 2862705112 Streptomyces triticirhizae NEAU-YY642 Isolate Rhizosphere
28 2863067949 Saccharopolyspora phatthalungensis DSM 45584 (Annotation) (version 2) Isolate Rhizosphere
29 2866612099 Amycolatopsis suaedae 8-3EHSu Isolate Unclassified
30 2867346516 Streptomyces radicis AZ1-7 Isolate Unclassified
31 2870721527 Saccharothrix ecbatanensis DSM 45486 Isolate Rhizosphere
32 2873314349 Sphaerisporangium siamense DSM 45784 Isolate Rhizosphere
33 2895880812 Frankia sp. BMG5.11 Isolate Unclassified
34 2915768154 Amycolatopsis pittospori PIP199 Isolate Unclassified
35 2917736166 Amycolatopsis dendrobii DR6-1 Isolate Unclassified
36 2990044586 Streptomyces sedi JCM 16909 Isolate Unclassified
37 2995463766 Streptacidiphilus fuscans NEAU-YB345 Isolate Unclassified
38 3002998708 Actinomadura barringtoniae GKU 128 Isolate Unclassified
39 3006321560 Actinacidiphila epipremni PRB2-1 Isolate Unclassified
40 3300003203 Tabebuia heterophylla rhizosphere microbial communities from the University of Puerto Rico - S4T2R2 Metagenome Rhizosphere
41 3300005347 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S4-3 metaG Metagenome Rhizosphere
42 3300005367 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-3 metaG Metagenome Rhizosphere
43 3300005435 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - LAR L8-3 metaG Metagenome Rhizosphere
44 3300005455 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C6-3 metaG Metagenome Rhizosphere
45 3300005563 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C5-2 Metagenome Rhizosphere
46 3300005578 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C4-2 Metagenome Rhizosphere
47 3300005842 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S1-2 Metagenome Rhizosphere
48 3300005937 Tabebuia heterophylla rhizosphere microbial communities from the University of Puerto Rico - S3T2R1 Metagenome Rhizosphere
49 3300005985 Tabebuia heterophylla rhizosphere microbial communities from the University of Puerto Rico - S4T2R2 Metagenome Rhizosphere
50 3300006846 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD4 Metagenome Rhizosphere
51 3300006847 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD5 Metagenome Rhizosphere
52 3300006880 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD3 Metagenome Rhizosphere
53 3300009101 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-4 metaG Metagenome Rhizosphere
54 3300009174 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C6-4 metaG Metagenome Rhizosphere
55 3300009177 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-4 metaG Metagenome Rhizosphere
56 3300009553 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S4-4 metaG Metagenome Rhizosphere
57 3300014968 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - S2-5 metaG Metagenome Rhizosphere
58 3300020075 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - Diel MetaT C5pm-5 (Metagenome Metatranscriptome) (v2) (version 2) Metatranscriptome Rhizosphere
59 3300022467 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - Diel MetaT C5pm-2 (Metagenome Metatranscriptome) (v2) (version 2) Metatranscriptome Rhizosphere
60 3300025302 Arabidopsis root microbial communities from the University of North Carolina, USA - plate scrape MF_Cvi_mMS (SPAdes) (version 2) Metagenome Endosphere
61 3300025900 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-4 metaG (SPAdes) (version 2) Metagenome Rhizosphere
62 3300025904 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - C2 (SPAdes) (version 2) Metagenome Rhizosphere
63 3300025913 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C5-4 metaG (SPAdes) (version 2) Metagenome Rhizosphere
64 3300025914 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C2-4 metaG (SPAdes) (version 2) Metagenome Rhizosphere
65 3300025924 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C3-4 metaG (SPAdes) (version 2) Metagenome Rhizosphere
66 3300025929 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - LAR L8-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
67 3300025986 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
68 3300026035 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S1-2 (SPAdes) (version 2) Metagenome Rhizosphere
69 3300026067 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C6-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
70 3300028786 Populus trichocarpa ectomycorrhiza microbial communities from riparian zone in the Pacific Northwest, United States - 23_EM Metagenome Unclassified
71 3300028794 Populus trichocarpa ectomycorrhiza microbial communities from riparian zone in the Pacific Northwest, United States - 17_EM Metagenome Unclassified
72 3300028800 Rhizosphere microbial communities from Carex aquatilis grown in University of Washington, Seatle, WA, United States - 4-21-26 metaG Metagenome Rhizosphere
73 3300030522 Populus trichocarpa ectomycorrhiza microbial communities from riparian zone in the Pacific Northwest, United States - 14_EM Metagenome Unclassified
74 3300030732 Rhizosphere soil microbial communities in infected wheat plant from Wellcamp field in Toowoomba, Australia - sample 1 Metagenome Rhizosphere
75 3300031616 Populus trichocarpa ectomycorrhiza microbial communities from riparian zone in the Pacific Northwest, United States - 9_EM Metagenome Unclassified
76 3300031838 Populus trichocarpa ectomycorrhiza microbial communities from riparian zone in the Pacific Northwest, United States - 25_EM Metagenome Unclassified
77 3300033179 Populus trichocarpa ectomycorrhiza microbial communities from riparian zone in the Pacific Northwest, United States - 7_EM Metagenome Unclassified
78 3300035083 Populus rhizosphere microbial communities from soil in Oregon, United States - GW9791_Oregon_NoN_17 Metagenome Rhizosphere
79 3300035119 Populus rhizosphere microbial communities from soil in Oregon, United States - WV94_Oregon_N_4 Metagenome Rhizosphere
80 3300035692 Populus rhizosphere microbial communities from soil in Oregon, United States - WV94_Oregon_NoN_11 Metagenome Rhizosphere
81 3300035725 Populus rhizosphere microbial communities from soil in Oregon, United States - GW9791_Oregon_N_8 Metagenome Rhizosphere
82 3300037853 Root-associated microbial communities from Barbacenia macrantha in rupestrian grasslands, the National Park of Serra do Cipo, Brazil - RX_R8 v2 Metagenome Unclassified
83 3300039450 Root-associated microbial communities from Barbacenia macrantha in rupestrian grasslands, the National Park of Serra do Cipo, Brazil - RX_R7 v2 Metagenome Unclassified
84 3300044656 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - COA1R Metagenome Rhizosphere
85 3300044658 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - COC1R Metagenome Rhizosphere
86 3300044683 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - COA3R Metagenome Rhizosphere
87 3300044684 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - COC4R Metagenome Rhizosphere
88 3300044693 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - COC2R Metagenome Rhizosphere
89 3300044706 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - CSA3R Metagenome Rhizosphere
90 3300044712 Rhizosphere soil microbial communities from rice plants in Newark, Delaware, United States - Rhiz_9IH_GED Metagenome Rhizosphere
91 3300044719 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - CSC1R Metagenome Rhizosphere
92 3300044735 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - CSA1R Metagenome Rhizosphere
93 3300044765 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - COA2R Metagenome Rhizosphere
94 3300045049 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - COC3R Metagenome Rhizosphere
95 3300045836 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - CSC4R Metagenome Rhizosphere
96 3300046454 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-198-CL2_38_5 rhizosphere Metagenome Rhizosphere
97 3300046459 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-448-CL3_88_32 rhizosphere Metagenome Rhizosphere
98 3300046462 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-86-CL2_69_17 rhizosphere Metagenome Rhizosphere
99 3300046516 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-448-CL1_35_3 rhizosphere Metagenome Rhizosphere
100 3300046522 Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-845-Co2_60_28 rhizosphere Metagenome Rhizosphere
101 3300046529 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-866-CL2_50_11 rhizosphere Metagenome Rhizosphere
102 3300046533 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-845-CL2_37_16 rhizosphere Metagenome Rhizosphere
103 3300046642 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-833-CL2_42_16 rhizosphere Metagenome Rhizosphere
104 3300046663 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-833-CL3_77_6 rhizosphere Metagenome Rhizosphere
105 3300046680 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-847-CL2_38_7 rhizosphere Metagenome Rhizosphere
106 3300046689 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-351-CL2_54_28 rhizosphere Metagenome Rhizosphere
107 3300046691 Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - GW-4579-Co3_14_51 rhizosphere Metagenome Rhizosphere
108 3300046810 Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-904-Co2_51_17 rhizosphere Metagenome Rhizosphere
109 3300047317 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-307-CL2_57_8 rhizosphere Metagenome Rhizosphere
110 3300047319 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - GW-9591-CL1_34_16 rhizosphere Metagenome Rhizosphere
111 3300047321 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - GW-9591-CL3_98_5 rhizosphere Metagenome Rhizosphere
112 3300047323 Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - SKWA-24-3-Co3_23_35 rhizosphere Metagenome Rhizosphere
113 3300047447 Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - SKWD-24-1-Co1_7_5 rhizosphere Metagenome Rhizosphere
114 3300047470 Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - SKWA-24-3-Co1_3_5 rhizosphere Metagenome Rhizosphere
115 3300048921 Root microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR root_1f N15 Metagenome Unclassified
116 3300048922 Root microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR root_2e N15 Metagenome Unclassified
117 3300048923 Root microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR root_2f N15 Metagenome Unclassified
118 3300048924 Root microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR root_3e N15 Metagenome Unclassified
119 3300049568 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - WT_TR_GHRAS_01 Metagenome Rhizosphere
120 3300049569 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - WT_TR_GHRAS_02 Metagenome Rhizosphere
121 3300049571 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L1_TR_GHRAS_01 Metagenome Rhizosphere
122 3300049572 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L1_TR_GHRAS_03 Metagenome Rhizosphere
123 3300049573 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L2_TR_GHRAS_01 Metagenome Rhizosphere
124 3300049574 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L2_TR_GHRAS_02 Metagenome Rhizosphere
125 3300049575 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L2_TR_GHRAS_03 Metagenome Rhizosphere
126 3300049579 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L4_TR_GHRAS_01 Metagenome Rhizosphere
127 3300049580 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L5_TR_GHRAS_01 Metagenome Rhizosphere
128 3300049581 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L5_TR_GHRAS_02 Metagenome Rhizosphere
129 3300049582 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L5_TR_GHRAS_03 Metagenome Rhizosphere
130 3300049583 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - WT_T2_FRAS_01 Metagenome Rhizosphere
131 3300049586 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L1_T2_FRAS_01 Metagenome Rhizosphere
132 3300049588 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L1_T2_FRAS_03 Metagenome Rhizosphere
133 3300049589 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L2_T2_FRAS_01 Metagenome Rhizosphere
134 3300049590 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L2_T2_FRAS_02 Metagenome Rhizosphere
135 3300049592 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L3_T2_FRAS_01 Metagenome Rhizosphere
136 3300049741 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L4_T2_FRAS_01 Metagenome Rhizosphere
137 3300049742 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L4_T2_FRAS_02 Metagenome Rhizosphere
138 3300049744 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L5_T2_FRAS_02 Metagenome Rhizosphere
139 3300049822 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L1_TR_GHRAS_02 Metagenome Rhizosphere
140 3300049823 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L4_TR_GHRAS_02 Metagenome Rhizosphere
141 3300050508 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD3 re-annotation Metagenome Rhizosphere
142 3300050509 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD4 re-annotation Metagenome Rhizosphere
143 3300050510 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD5 re-annotation Metagenome Rhizosphere
144 3300053086 Root microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-307-Co2_62_14 endosphere Metagenome Endosphere
145 3300053136 Root microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-133-CL2_62_7 endosphere Metagenome Endosphere
146 3300060353 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L5_T2_FRAS_01 Metagenome Rhizosphere
147 3300061719 Rhizosphere microbial communities from millet plant in semiarid region near Thies, Senegal - CSC2R1 Metagenome Rhizosphere
148 637000116 Frankia casuarinae CcI3 Isolate Nodule
149 8002775197 Frankia nepalensis CN7 Isolate Nodule
150 8002784119 Frankia sp. AgB1.9 Isolate Nodule
151 8003314358 Amycolatopsis sp. MtRt-6 Isolate Unclassified
152 8008485437 Streptomyces mimosae 3MP-10 Isolate Unclassified
153 8025478263 Streptomyces telluris AA8 Isolate Rhizosphere
154 8025524527 Streptomyces sp. 3MP-14 Isolate Unclassified
155 8047710418 Umezawaea endophytica DSM 103496 Isolate Unclassified
156 8053945823 Actinomadura terrae OS3-83 Isolate Rhizosphere
157 8054913762 Frankia gtarii Agncl-10 Isolate Nodule
158 8054920844 Frankia tisae Agncl-8 Isolate Nodule
159 8055066027 Sphaerisporangium corydalis NEAU-YHS15 Isolate Unclassified
160 8055157932 Frankia umida Ag45/Mut15 Isolate Nodule
161 8056060235 Nocardiopsis endophytica RSe5-2 Isolate Unclassified
162 8056207758 Saccharopolyspora indica KCTC 29208 Isolate Rhizosphere
163 8056667051 Streptomyces sichuanensis SCA3-4 Isolate Rhizosphere

Type Distribution

Type Percentage (%)
Metagenomes 70.92
Metatranscriptomes 1.02
Isolates 28.06

Biome Distribution

Category Percentage (%)
Aerial Root 0
Bulb 0
Endosphere 1.53
Nodule 10.2
Rhizoplane 0.51
Rhizosphere 71.43
Stem 0
Stem Tuber 0
Unclassified 16.33

Taxonomy

Scaffolds

Scaffold Dataset Taxonomy Length
1 JGI25406J46586_10003108 3300003203 Bacteria 7806
2 Ga0070668_100001354 3300005347 Bacteria 17526
3 Ga0070667_100020400 3300005367 Bacteria 5502
4 Ga0070714_100041609 3300005435 Bacteria 3878
5 Ga0070663_100019379 3300005455 Bacteria 4482
6 Ga0068855_100010164 3300005563 Bacteria 11342
7 Ga0068854_100007460 3300005578 Bacteria 6990
8 Ga0068858_100000152 3300005842 Bacteria 72991
9 Ga0081455_10000025 3300005937 Bacteria 157583
10 Ga0081539_10000769 3300005985 Bacteria 63034
11 Ga0075430_100005179 3300006846 Bacteria 10982
12 Ga0075431_100005611 3300006847 Bacteria 12395
13 Ga0075429_100001894 3300006880 Bacteria 17338
14 Ga0105247_10000262 3300009101 Bacteria 48787
15 Ga0105247_10003289 3300009101 Bacteria 10588
16 Ga0105241_10002752 3300009174 Bacteria 13181
17 Ga0105248_10009655 3300009177 Bacteria 10628
18 Ga0105249_10012391 3300009553 Bacteria 7514
19 Ga0157379_10000543 3300014968 Bacteria 30457
20 Ga0157379_10018415 3300014968 Bacteria 6158
21 Ga0206349_1734342 3300020075 Bacteria 3840
22 Ga0224712_10007030 3300022467 Bacteria 3251
23 Ga0207426_1007752 3300025302 Bacteria 4452
24 Ga0207710_10000040 3300025900 Bacteria 229443
25 Ga0207710_10000168 3300025900 Bacteria 69338
26 Ga0207647_10003854 3300025904 Bacteria 11217
27 Ga0207695_10004363 3300025913 Bacteria 19375
28 Ga0207671_10000531 3300025914 Bacteria 51420
29 Ga0207694_10000980 3300025924 Bacteria 25005
30 Ga0207664_10018393 3300025929 Bacteria 5143
31 Ga0207658_10020946 3300025986 Bacteria 4532
32 Ga0207703_10000181 3300026035 Bacteria 73537
33 Ga0207678_10001113 3300026067 Bacteria 24636
34 Ga0307517_10004181 3300028786 Bacteria 22271
35 Ga0307515_10016557 3300028794 Bacteria 13493
36 Ga0265338_10057109 3300028800 Bacteria 3455
37 Ga0307512_10013720 3300030522 Bacteria 7578
38 Ga0316176_1225754 3300030732 Bacteria 3405
39 Ga0307508_10067456 3300031616 Bacteria 3146
40 Ga0307518_10000268 3300031838 Bacteria 39200
41 Ga0307507_10012722 3300033179 Bacteria 10341
42 Ga0373926_0000136 3300035083 Bacteria 15427
43 Ga0373956_0000750 3300035119 Bacteria 13404
44 Ga0373935_0002281 3300035692 Bacteria 10918
45 Ga0373947_0000001 3300035725 Bacteria 510932
46 Ga0436364_1120958 3300037853 Bacteria 4939
47 Ga0436363_0442712 3300039450 Bacteria 3694
48 Ga0466969_0000283 3300044656 Bacteria 27749
49 Ga0466969_0005958 3300044656 Bacteria 6487
50 Ga0466969_0006777 3300044656 Bacteria 6094
51 Ga0466969_0011560 3300044656 Bacteria 4673
52 Ga0466972_0001961 3300044658 Bacteria 10088
53 Ga0466972_0008857 3300044658 Bacteria 5050
54 Ga0466965_0013509 3300044683 Bacteria 3854
55 Ga0466966_0000355 3300044684 Bacteria 29762
56 Ga0466961_0006629 3300044693 Bacteria 7364
57 Ga0466964_0000130 3300044706 Bacteria 19859
58 Ga0453684_0004080 3300044712 Bacteria 31722
59 Ga0466971_0000501 3300044719 Bacteria 15356
60 Ga0466968_0000006 3300044735 Bacteria 77600
61 Ga0466970_0000006 3300044765 Bacteria 102550
62 Ga0466959_0006787 3300045049 Bacteria 7975
63 Ga0466959_0024434 3300045049 Bacteria 4476
64 Ga0466959_0043721 3300045049 Bacteria 3301
65 Ga0466958_0050126 3300045836 Bacteria 2527
66 Ga0466958_0051620 3300045836 Bacteria 2490
67 Ga0495592_0003362 3300046454 Bacteria 11453
68 Ga0495629_0044983 3300046459 Bacteria 3098
69 Ga0495651_0003402 3300046462 Bacteria 12197
70 Ga0495651_0008991 3300046462 Bacteria 7668
71 Ga0495628_0071062 3300046516 Bacteria 2713
72 Ga0495643_0002337 3300046522 Bacteria 15234
73 Ga0495652_0025948 3300046529 Bacteria 5177
74 Ga0495640_0006759 3300046533 Bacteria 9049
75 Ga0495640_0027606 3300046533 Bacteria 4092
76 Ga0495634_0003734 3300046642 Bacteria 12128
77 Ga0495635_0019194 3300046663 Bacteria 4770
78 Ga0495646_0011614 3300046680 Bacteria 5596
79 Ga0495613_0006091 3300046689 Bacteria 9022
80 Ga0495670_0007664 3300046691 Bacteria 5307
81 Ga0495660_0000982 3300046810 Bacteria 20800
82 Ga0495604_0007586 3300047317 Bacteria 8586
83 Ga0495604_0030630 3300047317 Bacteria 4272
84 Ga0495674_0070031 3300047319 Bacteria 3032
85 Ga0495676_0002474 3300047321 Bacteria 16429
86 Ga0495683_0000527 3300047323 Bacteria 28999
87 Ga0495685_001608 3300047447 Bacteria 6970
88 Ga0495681_0001026 3300047470 Bacteria 21346
89 Ga0496118_0062205 3300048921 Bacteria 2758
90 Ga0496119_0020648 3300048922 Bacteria 4794
91 Ga0496119_0042437 3300048922 Bacteria 2884
92 Ga0496120_0002309 3300048923 Bacteria 19738
93 Ga0496121_0003574 3300048924 Bacteria 21974
94 Ga0501031_0006424 3300049568 Bacteria 7667
95 Ga0501031_0036926 3300049568 Bacteria 3188
96 Ga0501032_0004202 3300049569 Bacteria 10904
97 Ga0501032_0004496 3300049569 Bacteria 10498
98 Ga0501032_0006169 3300049569 Bacteria 8821
99 Ga0501034_0026860 3300049571 Bacteria 5857
100 Ga0501034_0055897 3300049571 Bacteria 3972
101 Ga0501034_0117523 3300049571 Bacteria 2646
102 Ga0501036_0019176 3300049572 Bacteria 5738
103 Ga0501036_0029970 3300049572 Bacteria 4597
104 Ga0501037_0010215 3300049573 Bacteria 6887
105 Ga0501037_0045185 3300049573 Bacteria 3233
106 Ga0501038_0001792 3300049574 Bacteria 19941
107 Ga0501038_0094350 3300049574 Bacteria 2501
108 Ga0501039_0010374 3300049575 Bacteria 7105
109 Ga0501043_0016218 3300049579 Bacteria 5844
110 Ga0501043_0069099 3300049579 Bacteria 2774
111 Ga0501043_0075542 3300049579 Bacteria 2646
112 Ga0501046_0016442 3300049580 Bacteria 6196
113 Ga0501047_0006548 3300049581 Bacteria 10965
114 Ga0501047_0018162 3300049581 Bacteria 6740
115 Ga0501047_0026686 3300049581 Bacteria 5559
116 Ga0501048_0001539 3300049582 Bacteria 17504
117 Ga0501048_0060749 3300049582 Bacteria 2677
118 Ga0501067_0034370 3300049583 Bacteria 2813
119 Ga0501070_0021902 3300049586 Bacteria 5354
120 Ga0501072_0015085 3300049588 Bacteria 5925
121 Ga0501073_0033782 3300049589 Bacteria 3640
122 Ga0501074_0021156 3300049590 Bacteria 4725
123 Ga0501076_0016345 3300049592 Bacteria 5627
124 Ga0501079_0014683 3300049741 Bacteria 5970
125 Ga0501080_0079510 3300049742 Bacteria 3048
126 Ga0501083_0002112 3300049744 Bacteria 13636
127 Ga0501035_0003277 3300049822 Bacteria 15517
128 Ga0501035_0012498 3300049822 Bacteria 7844
129 Ga0501035_0054882 3300049822 Bacteria 3558
130 Ga0501044_0006054 3300049823 Bacteria 13350
131 Ga0501044_0013506 3300049823 Bacteria 8830
132 Ga0501044_0029790 3300049823 Bacteria 5754
133 Ga0501044_0054233 3300049823 Bacteria 4122
134 nmdc:mga09592_2065_c1 3300050508 Bacteria 16192
135 nmdc:mga0qj67_76363_c1 3300050509 Bacteria 2679
136 nmdc:mga06r32_1330_c4 3300050510 Bacteria 6592
137 nmdc:mga06r32_7797_c1 3300050510 Bacteria 9623
138 Ga0500578_0022792 3300053086 Bacteria 4020
139 Ga0500559_0021754 3300053136 Bacteria 2719
140 Ga0501082_0018213 3300060353 Bacteria 6047
141 Ga0466962_0000303 3300061719 Bacteria 21120

MSA Aligner

Download Fasta Download Aligned Fasta

Family Sequences

Sample Scaffold Protein Protein Length
1 3300048923 Ga0496120_0002309 Ga0496120_0002309_17498_19663 666
2 3300035119 Ga0373956_0000750 Ga0373956_0000750_8081_10402 669
3 3300005367 Ga0070667_100020400 Ga0070667_1000204002 677
4 3300025986 Ga0207658_10020946 Ga0207658_100209463 677
5 3300046691 Ga0495670_0007664 Ga0495670_0007664_384_2510 678
6 3300047447 Ga0495685_001608 Ga0495685_001608_3480_5606 678
7 3300047470 Ga0495681_0001026 Ga0495681_0001026_2393_4519 678
8 3300049571 Ga0501034_0055897 Ga0501034_0055897_67_2481 678
9 3300053086 Ga0500578_0022792 Ga0500578_0022792_1828_3954 678
10 3300050510 nmdc:mga06r32_1330_c4 nmdc:mga06r32_1330_c4_3765_5855 682
11 3300009101 Ga0105247_10003289 Ga0105247_100032892 686
12 3300048921 Ga0496118_0062205 Ga0496118_0062205_43_2280 686
13 3300048922 Ga0496119_0042437 Ga0496119_0042437_183_2393 690
14 3300037853 Ga0436364_1120958 Ga0436364_1120958_2396_4693 694
15 iso_pu_bacteria 3002998708 3002999458 694
16 3300025302 Ga0207426_1007752 Ga0207426_10077523 698
17 iso_pu_bacteria 8055066027 8055066642 698
18 3300046462 Ga0495651_0008991 Ga0495651_0008991_2873_5044 699
19 3300046529 Ga0495652_0025948 Ga0495652_0025948_1596_3767 699
20 3300046663 Ga0495635_0019194 Ga0495635_0019194_1969_4140 699
21 3300046680 Ga0495646_0011614 Ga0495646_0011614_2996_5167 699
22 3300047319 Ga0495674_0070031 Ga0495674_0070031_785_2956 699
23 3300049568 Ga0501031_0036926 Ga0501031_0036926_125_2467 699
24 3300049569 Ga0501032_0004496 Ga0501032_0004496_811_3471 699
25 3300049571 Ga0501034_0026860 Ga0501034_0026860_1754_4414 699
26 3300049573 Ga0501037_0010215 Ga0501037_0010215_1659_4319 699
27 3300049575 Ga0501039_0010374 Ga0501039_0010374_265_2937 699
28 3300049579 Ga0501043_0016218 Ga0501043_0016218_1890_4709 699
29 3300049581 Ga0501047_0006548 Ga0501047_0006548_4712_7372 699
30 iso_pu_bacteria 2585427649 2586065028 699
31 3300009101 Ga0105247_10000262 Ga0105247_1000026226 700
32 3300009177 Ga0105248_10009655 Ga0105248_100096556 700
33 3300014968 Ga0157379_10018415 Ga0157379_100184153 700
34 3300025900 Ga0207710_10000040 Ga0207710_1000004023 700
35 3300039450 Ga0436363_0442712 Ga0436363_0442712_209_2455 700
36 3300048922 Ga0496119_0020648 Ga0496119_0020648_50_2317 700
37 3300005578 Ga0068854_100007460 Ga0068854_1000074604 702
38 3300049569 Ga0501032_0004202 Ga0501032_0004202_172_2445 703
39 3300049571 Ga0501034_0117523 Ga0501034_0117523_172_2445 703
40 3300049572 Ga0501036_0029970 Ga0501036_0029970_2109_4382 703
41 3300049573 Ga0501037_0045185 Ga0501037_0045185_759_3032 703
42 3300049574 Ga0501038_0094350 Ga0501038_0094350_202_2475 703
43 3300049579 Ga0501043_0075542 Ga0501043_0075542_172_2445 703
44 3300049580 Ga0501046_0016442 Ga0501046_0016442_442_2715 703
45 3300049581 Ga0501047_0018162 Ga0501047_0018162_4296_6569 703
46 3300049582 Ga0501048_0060749 Ga0501048_0060749_233_2506 703
47 3300049586 Ga0501070_0021902 Ga0501070_0021902_2302_4575 703
48 3300049588 Ga0501072_0015085 Ga0501072_0015085_351_2624 703
49 3300049592 Ga0501076_0016345 Ga0501076_0016345_186_2459 703
50 3300049741 Ga0501079_0014683 Ga0501079_0014683_203_2476 703
51 3300049742 Ga0501080_0079510 Ga0501080_0079510_737_3010 703
52 3300049744 Ga0501083_0002112 Ga0501083_0002112_463_2736 703
53 3300049823 Ga0501044_0013506 Ga0501044_0013506_378_2651 703
54 3300060353 Ga0501082_0018213 Ga0501082_0018213_3482_5755 703
55 iso_pu_bacteria 8053945823 8053949551 703
56 3300005563 Ga0068855_100010164 Ga0068855_1000101641 705
57 3300009174 Ga0105241_10002752 Ga0105241_100027521 705
58 3300025904 Ga0207647_10003854 Ga0207647_100038546 705
59 3300025913 Ga0207695_10004363 Ga0207695_100043631 705
60 3300025914 Ga0207671_10000531 Ga0207671_100005312 705
61 3300025924 Ga0207694_10000980 Ga0207694_100009801 705
62 3300046533 Ga0495640_0027606 Ga0495640_0027606_1639_4023 705
63 3300049583 Ga0501067_0034370 Ga0501067_0034370_389_2662 705
64 3300031838 Ga0307518_10000268 Ga0307518_100002689 706
65 3300044693 Ga0466961_0006629 Ga0466961_0006629_4934_7189 706
66 3300044719 Ga0466971_0000501 Ga0466971_0000501_841_3096 706
67 3300045049 Ga0466959_0006787 Ga0466959_0006787_4276_6531 706
68 3300045836 Ga0466958_0051620 Ga0466958_0051620_22_2277 706
69 3300046462 Ga0495651_0003402 Ga0495651_0003402_755_2941 706
70 3300047317 Ga0495604_0030630 Ga0495604_0030630_1853_4039 706
71 3300061719 Ga0466962_0000303 Ga0466962_0000303_6171_8426 706
72 iso_pu_bacteria 2675903060 2676490363 706
73 3300022467 Ga0224712_10007030 Ga0224712_100070301 707
74 iso_pu_bacteria 2862705112 2862710507 707
75 iso_pu_bacteria 2990044586 2990048782 707
76 iso_pu_bacteria 8008485437 8008486142 707
77 iso_pu_bacteria 8025524527 8025525458 707
78 3300049822 Ga0501035_0054882 Ga0501035_0054882_316_3126 708
79 3300049823 Ga0501044_0006054 Ga0501044_0006054_9730_12540 708
80 iso_pu_bacteria 8003314358 8003316628 708
81 3300005435 Ga0070714_100041609 Ga0070714_1000416092 709
82 3300049568 Ga0501031_0006424 Ga0501031_0006424_4847_7084 709
83 3300049569 Ga0501032_0006169 Ga0501032_0006169_5847_8084 709
84 3300049572 Ga0501036_0019176 Ga0501036_0019176_323_2560 709
85 3300049581 Ga0501047_0026686 Ga0501047_0026686_545_2782 709
86 3300049822 Ga0501035_0003277 Ga0501035_0003277_11310_13547 709
87 3300049823 Ga0501044_0029790 Ga0501044_0029790_2351_4588 709
88 3300005455 Ga0070663_100019379 Ga0070663_1000193794 710
89 3300026067 Ga0207678_10001113 Ga0207678_1000111320 710
90 3300005347 Ga0070668_100001354 Ga0070668_1000013546 711
91 3300044656 Ga0466969_0005958 Ga0466969_0005958_3379_5802 711
92 3300045049 Ga0466959_0043721 Ga0466959_0043721_655_3078 711
93 iso_pu_bacteria 8056207758 8056214450 711
94 3300049582 Ga0501048_0001539 Ga0501048_0001539_2840_5362 712
95 3300049590 Ga0501074_0021156 Ga0501074_0021156_2131_4653 712
96 iso_pu_bacteria 2751185734 2753071639 712
97 iso_pu_bacteria 2795385472 2795792592 712
98 iso_pu_bacteria 2867346516 2867350406 712
99 iso_pu_bacteria 2870721527 2870729402 712
100 3300030732 Ga0316176_1225754 Ga0316176_12257542 713
101 3300044712 Ga0453684_0004080 Ga0453684_0004080_27748_29988 713
102 iso_pu_bacteria 2775506925 2776375114 713
103 iso_pu_bacteria 2863067949 2863073464 713
104 3300028786 Ga0307517_10004181 Ga0307517_100041816 714
105 3300046522 Ga0495643_0002337 Ga0495643_0002337_2698_4947 714
106 3300046810 Ga0495660_0000982 Ga0495660_0000982_16643_18892 714
107 3300049574 Ga0501038_0001792 Ga0501038_0001792_15837_18359 714
108 3300049579 Ga0501043_0069099 Ga0501043_0069099_179_2701 714
109 3300049589 Ga0501073_0033782 Ga0501073_0033782_81_2603 714
110 3300049823 Ga0501044_0054233 Ga0501044_0054233_100_2622 714
111 3300031616 Ga0307508_10067456 Ga0307508_100674561 715
112 3300035083 Ga0373926_0000136 Ga0373926_0000136_6987_9194 715
113 3300035692 Ga0373935_0002281 Ga0373935_0002281_6333_8540 715
114 3300035725 Ga0373947_0000001 Ga0373947_0000001_131127_133334 715
115 iso_pu_bacteria 2808606522 2809593429 715
116 iso_pu_bacteria 2915768154 2915769423 715
117 iso_pu_bacteria 2995463766 2995471471 715
118 iso_pu_bacteria 3006321560 3006322425 715
119 iso_pu_bacteria 8056667051 8056668405 715
120 3300049822 Ga0501035_0012498 Ga0501035_0012498_1922_4174 716
121 3300045049 Ga0466959_0024434 Ga0466959_0024434_213_2516 717
122 3300045836 Ga0466958_0050126 Ga0466958_0050126_162_2462 717
123 iso_pu_bacteria 2527291627 2528205914 717
124 iso_pu_bacteria 2527291629 2528215069 717
125 iso_pu_bacteria 2551306166 2552109419 717
126 iso_pu_bacteria 2579778521 2579858024 717
127 iso_pu_bacteria 2619618881 2619854880 717
128 iso_pu_bacteria 2619619003 2620353754 717
129 iso_pu_bacteria 2626541554 2626639987 717
130 iso_pu_bacteria 2684623036 2686540630 717
131 iso_pu_bacteria 2773857933 2774905654 717
132 iso_pu_bacteria 2866612099 2866617877 717
133 iso_pu_bacteria 637000116 637881557 717
134 iso_pu_bacteria 8054913762 8054914834 717
135 iso_pu_bacteria 8054920844 8054921941 717
136 iso_pu_bacteria 8055157932 8055159360 717
137 iso_pu_bacteria 8056060235 8056066168 717
138 3300005937 Ga0081455_10000025 Ga0081455_10000025154 718
139 3300030522 Ga0307512_10013720 Ga0307512_100137206 718
140 3300044656 Ga0466969_0011560 Ga0466969_0011560_401_2956 718
141 iso_pu_bacteria 8047710418 8047718812 718
142 3300006846 Ga0075430_100005179 Ga0075430_1000051797 719
143 3300006847 Ga0075431_100005611 Ga0075431_10000561112 719
144 3300006880 Ga0075429_100001894 Ga0075429_1000018944 719
145 3300046454 Ga0495592_0003362 Ga0495592_0003362_2034_4322 719
146 3300046459 Ga0495629_0044983 Ga0495629_0044983_301_2619 719
147 3300046516 Ga0495628_0071062 Ga0495628_0071062_260_2548 719
148 3300046533 Ga0495640_0006759 Ga0495640_0006759_2013_4301 719
149 3300046642 Ga0495634_0003734 Ga0495634_0003734_9227_11515 719
150 3300046689 Ga0495613_0006091 Ga0495613_0006091_1129_3417 719
151 3300047317 Ga0495604_0007586 Ga0495604_0007586_2004_4292 719
152 3300047321 Ga0495676_0002474 Ga0495676_0002474_12098_14386 719
153 3300050508 nmdc:mga09592_2065_c1 nmdc:mga09592_2065_c1_9591_11846 719
154 3300050510 nmdc:mga06r32_7797_c1 nmdc:mga06r32_7797_c1_7091_9346 719
155 3300053136 Ga0500559_0021754 Ga0500559_0021754_45_2249 719
156 iso_pu_bacteria 2546825537 2546948725 719
157 iso_pu_bacteria 2576861822 2579750249 719
158 iso_pu_bacteria 2684623035 2686535654 719
159 iso_pu_bacteria 2710264753 2710604868 719
160 iso_pu_bacteria 2773857924 2774867671 719
161 iso_pu_bacteria 2873314349 2873316114 719
162 iso_pu_bacteria 2895880812 2895885408 719
163 iso_pu_bacteria 2917736166 2917743806 719
164 iso_pu_bacteria 8025478263 8025485433 719
165 3300005842 Ga0068858_100000152 Ga0068858_10000015229 720
166 3300014968 Ga0157379_10000543 Ga0157379_100005432 720
167 3300020075 Ga0206349_1734342 Ga0206349_17343422 720
168 3300025900 Ga0207710_10000168 Ga0207710_100001688 720
169 3300025929 Ga0207664_10018393 Ga0207664_100183934 720
170 3300026035 Ga0207703_10000181 Ga0207703_1000018127 720
171 3300028800 Ga0265338_10057109 Ga0265338_100571092 720
172 3300044656 Ga0466969_0000283 Ga0466969_0000283_12586_14826 720
173 3300044656 Ga0466969_0006777 Ga0466969_0006777_3545_5785 720
174 3300044658 Ga0466972_0001961 Ga0466972_0001961_7016_9256 720
175 3300044683 Ga0466965_0013509 Ga0466965_0013509_423_2663 720
176 3300044684 Ga0466966_0000355 Ga0466966_0000355_3759_5999 720
177 3300044706 Ga0466964_0000130 Ga0466964_0000130_11570_13810 720
178 3300044735 Ga0466968_0000006 Ga0466968_0000006_71311_73551 720
179 3300044765 Ga0466970_0000006 Ga0466970_0000006_87728_89968 720
180 3300048924 Ga0496121_0003574 Ga0496121_0003574_11188_13494 720
181 3300050509 nmdc:mga0qj67_76363_c1 nmdc:mga0qj67_76363_c1_328_2601 720
182 iso_pu_bacteria 2675902999 2676199235 720
183 iso_pu_bacteria 2687453743 2689994555 720
184 iso_pu_bacteria 2773857921 2774843813 720
185 iso_pu_bacteria 2795385470 2795782545 720
186 iso_pu_bacteria 8002784119 8002787912 720
187 3300028794 Ga0307515_10016557 Ga0307515_100165579 721
188 3300033179 Ga0307507_10012722 Ga0307507_100127227 721
189 3300044658 Ga0466972_0008857 Ga0466972_0008857_1011_3224 721
190 3300009553 Ga0105249_10012391 Ga0105249_100123915 722
191 3300047323 Ga0495683_0000527 Ga0495683_0000527_26661_28910 722
192 3300003203 JGI25406J46586_10003108 JGI25406J46586_100031082 724
193 3300005985 Ga0081539_10000769 Ga0081539_1000076952 724
194 iso_pu_bacteria 2671180195 2671836286 724
195 iso_pu_bacteria 2773857922 2774854442 724
196 iso_pu_bacteria 8002775197 8002776571 724

Functional Annotation

PFAM ID Name Description Start Position End Position Accuracy

PF19086

Terpene_syn_C_2

Terpene synthase family 2, C-terminal metal binding

573

778

0.97

PF19086

Terpene_syn_C_2

Terpene synthase family 2, C-terminal metal binding

155

370

0.93

Structural Annotation

Top 5 Hits

ID Description Score Start End
5dz2-assembly2.cif.gz_B geosmin synthase from streptomyces coelicolor n-terminal domain complexed with three mg2+ ions and alendronic acid 0.9808 2 330
5dz2-assembly2.cif.gz_B geosmin synthase from streptomyces coelicolor n-terminal domain complexed with three mg2+ ions and alendronic acid 0.9748 2 330
5dw7-assembly1.cif.gz_A crystal structure of the unliganded geosmin synthase n-terminal domain from streptomyces coelicolor 0.9693 2 329
5dw7-assembly1.cif.gz_A crystal structure of the unliganded geosmin synthase n-terminal domain from streptomyces coelicolor 0.9662 2 329
5nx7-assembly1.cif.gz_B crystal structure of 1,8-cineole synthase from streptomyces clavuligerus in complex with 2-fluoroneryl diphosphate and 2-fluorogeranyl diphosphate 0.935 5 328
ID Description Score Start End Superfamily
5dw7A00 Mainly Alpha;Orthogonal Bundle;Farnesyl Diphosphate Synthase;Farnesyl Diphosphate Synthase 0.9693 2 329 1.10.600.10
5dw7A00 Mainly Alpha;Orthogonal Bundle;Farnesyl Diphosphate Synthase;Farnesyl Diphosphate Synthase 0.9662 2 329 1.10.600.10
5i1uB00 Mainly Alpha;Orthogonal Bundle;Farnesyl Diphosphate Synthase;Farnesyl Diphosphate Synthase 0.9237 9 321 1.10.600.10
4mc3A00 Mainly Alpha;Orthogonal Bundle;Farnesyl Diphosphate Synthase;Farnesyl Diphosphate Synthase 0.9158 4 322 1.10.600.10
1hm4A00 Mainly Alpha;Orthogonal Bundle;Farnesyl Diphosphate Synthase;Farnesyl Diphosphate Synthase 0.9156 7 322 1.10.600.10
ID Description Score Start End GO Terms
AF-H6UK75-F1-model_v4 Putative germacradienol synthase 0.9822 107 315
AF-A0A3R8RMQ3-F1-model_v4 Terpene synthase 0.9771 81 329 GO:0016829
AF-A0A7W7C5R0-F1-model_v4 Terpene synthase (EC 4.2.3.-) 0.974 2 339 GO:0010333
GO:0046872
AF-H6UK75-F1-model_v4 Putative germacradienol synthase 0.9684 107 315
AF-A0A6G3XG58-F1-model_v4 Germacradienol/geosmin synthase 0.9668 385 510

Feature Viewer

pLDDT pTM Quality
89.12 0.89 High
Powered by Feature Viewer

Predicted Structure (AlphaFold2)

Powered by PDBe Molstar
Download PDB Download HMM

Map