F485304
General Info
| Members | Datasets | Scaffolds | Average Seq Length |
|---|---|---|---|
| 905 | 293 | 1810 | 446 |
Family's Representative Sequence
| Representative Sequence | 3300005354|Ga0070675_100059542|Ga0070675_1000595423 |
| Length | 497 |
| Sequence | MLRCAVVFNGRTIRTICSSCGLWLRTRRADNRDEPPQRHAASKITVDELTFAARRAIASPSKTTEAPDLETRFRNLVQSPLRAGILRFLSARPEEGFDVEMLMSTFGRLRLDVENCVNELVGFGVVRRSPPSPGAHPRYTAARPLDEDSAVLLDTFLERRAAISTEDQAPSVQRFREMIGRDEKMLIVFEWIRTAAKSDISVLILGPTGSGKEVVARMIHELSRRGTEKFQAVNCAALPDTLFESEIFGFEKGAFTGAHDRKPGRLELADHGTLFLDEIGDLSLMAQAKLLRVLEDRRFERLGGQKSLQVDFRLISATNRPLEQFVRDSRFREDLYYRVNAFSIRLPSLRERPVDIPVLANRFIARYCASNGLPLDAKTLSSEAVSRLQSYPWPGNIRELESTVSRAALSAPGRVIRDNDIEFLHAGVSMPVTDGPPRLPTLRDAERAHIVRVLDAVSWNKKEAARVLEISRGTLYRKIVEYSLEPETRTSRNKTPE |
Samples
| Sample ID | Description | Type | Environment | |
|---|---|---|---|---|
| 1 | 3300005354 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M4-3 metaG | Metagenome | Rhizosphere |
| 2 | 3300001977 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - M5 | Metagenome | Rhizosphere |
| 3 | 3300003203 | Tabebuia heterophylla rhizosphere microbial communities from the University of Puerto Rico - S4T2R2 | Metagenome | Rhizosphere |
| 4 | 3300005289 | Switchgrass rhizosphere bacterial communities from Rose Lake, Michigan, USA - RL2 v2 (version 2) | Metagenome | Rhizosphere |
| 5 | 3300005290 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, MSU, sample Rhizosphere Soil Replicate 1: eDNA_1 v3 (version 3) | Metagenome | Rhizosphere |
| 6 | 3300005293 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, MSU, sample Bulk Soil Replicate 1 : eDNA_1 v2 (version 2) | Metagenome | Rhizosphere |
| 7 | 3300005295 | Switchgrass rhizosphere bacterial communities from Rose Lake, Michigan, USA - RL3 v2 (version 2) | Metagenome | Rhizosphere |
| 8 | 3300005328 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M5-3 metaG | Metagenome | Rhizosphere |
| 9 | 3300005329 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7.1-3L metaG | Metagenome | Rhizosphere |
| 10 | 3300005330 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-3H metaG | Metagenome | Rhizosphere |
| 11 | 3300005331 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S6-3 metaG | Metagenome | Rhizosphere |
| 12 | 3300005333 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M6-3 metaG | Metagenome | Rhizosphere |
| 13 | 3300005334 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M5-2 | Metagenome | Rhizosphere |
| 14 | 3300005335 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-3 metaG | Metagenome | Rhizosphere |
| 15 | 3300005336 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7-3B metaG | Metagenome | Rhizosphere |
| 16 | 3300005338 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M4-2 | Metagenome | Rhizosphere |
| 17 | 3300005339 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C3-3 metaG | Metagenome | Rhizosphere |
| 18 | 3300005340 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-3H metaG | Metagenome | Rhizosphere |
| 19 | 3300005341 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-10-1 metaG | Metagenome | Rhizosphere |
| 20 | 3300005343 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-3L metaG | Metagenome | Rhizosphere |
| 21 | 3300005347 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S4-3 metaG | Metagenome | Rhizosphere |
| 22 | 3300005353 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S5-3 metaG | Metagenome | Rhizosphere |
| 23 | 3300005355 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S7-3 metaG | Metagenome | Rhizosphere |
| 24 | 3300005356 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M3-3 metaG | Metagenome | Rhizosphere |
| 25 | 3300005364 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M2-3 metaG | Metagenome | Rhizosphere |
| 26 | 3300005365 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S1-3H metaG | Metagenome | Rhizosphere |
| 27 | 3300005366 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C2-3 metaG | Metagenome | Rhizosphere |
| 28 | 3300005367 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-3 metaG | Metagenome | Rhizosphere |
| 29 | 3300005438 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K5-10-2 metaG | Metagenome | Rhizosphere |
| 30 | 3300005440 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K5-25-3 metaG | Metagenome | Rhizosphere |
| 31 | 3300005441 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K5-10-1 metaG | Metagenome | Rhizosphere |
| 32 | 3300005444 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-25-1 metaG | Metagenome | Rhizosphere |
| 33 | 3300005455 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C6-3 metaG | Metagenome | Rhizosphere |
| 34 | 3300005456 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M7-3 metaG | Metagenome | Rhizosphere |
| 35 | 3300005457 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C5-3 metaG | Metagenome | Rhizosphere |
| 36 | 3300005458 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C8-3B metaG | Metagenome | Rhizosphere |
| 37 | 3300005459 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M3-2 | Metagenome | Rhizosphere |
| 38 | 3300005466 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S1-3L metaG | Metagenome | Rhizosphere |
| 39 | 3300005468 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K5-50-2 metaG | Metagenome | Rhizosphere |
| 40 | 3300005471 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-50-2 metaG | Metagenome | Rhizosphere |
| 41 | 3300005518 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-50-3 metaG | Metagenome | Rhizosphere |
| 42 | 3300005530 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C6-3B metaG | Metagenome | Rhizosphere |
| 43 | 3300005535 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7.2-3L metaG | Metagenome | Rhizosphere |
| 44 | 3300005536 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-50-1 metaG | Metagenome | Rhizosphere |
| 45 | 3300005543 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M1-3 metaG | Metagenome | Rhizosphere |
| 46 | 3300005544 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-3L metaG | Metagenome | Rhizosphere |
| 47 | 3300005545 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-25-2 metaG | Metagenome | Rhizosphere |
| 48 | 3300005546 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-25-3 metaG | Metagenome | Rhizosphere |
| 49 | 3300005547 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-10-3 metaG | Metagenome | Rhizosphere |
| 50 | 3300005548 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S1-3 metaG | Metagenome | Rhizosphere |
| 51 | 3300005549 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K5-25-2 metaG | Metagenome | Rhizosphere |
| 52 | 3300005563 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C5-2 | Metagenome | Rhizosphere |
| 53 | 3300005564 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7-3 metaG | Metagenome | Rhizosphere |
| 54 | 3300005577 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C7-2 | Metagenome | Rhizosphere |
| 55 | 3300005616 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C2-2 | Metagenome | Rhizosphere |
| 56 | 3300005617 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S2-2 | Metagenome | Rhizosphere |
| 57 | 3300005618 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S7-2 | Metagenome | Rhizosphere |
| 58 | 3300005718 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M2-2 | Metagenome | Rhizosphere |
| 59 | 3300005719 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S4-2 | Metagenome | Rhizosphere |
| 60 | 3300005840 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M6-2 | Metagenome | Rhizosphere |
| 61 | 3300005841 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S6-2 | Metagenome | Rhizosphere |
| 62 | 3300005842 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S1-2 | Metagenome | Rhizosphere |
| 63 | 3300005843 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S3-2 | Metagenome | Rhizosphere |
| 64 | 3300005844 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S5-2 | Metagenome | Rhizosphere |
| 65 | 3300005937 | Tabebuia heterophylla rhizosphere microbial communities from the University of Puerto Rico - S3T2R1 | Metagenome | Rhizosphere |
| 66 | 3300005985 | Tabebuia heterophylla rhizosphere microbial communities from the University of Puerto Rico - S4T2R2 | Metagenome | Rhizosphere |
| 67 | 3300006051 | Populus endosphere microbial communities from Tennessee, USA - Endosphere MetaG P. deltoides DD176-4 | Metagenome | Endosphere |
| 68 | 3300006178 | Populus endosphere microbial communities from Tennessee, USA - Endosphere MetaG P. TD hybrid TD303-2 | Metagenome | Endosphere |
| 69 | 3300006195 | Populus endosphere microbial communities from Tennessee, USA - Endosphere MetaG P. TD hybrid TD303-1 | Metagenome | Endosphere |
| 70 | 3300006237 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M7-2 (version 2) (version 2) | Metagenome | Rhizosphere |
| 71 | 3300006358 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M7-2 | Metagenome | Rhizosphere |
| 72 | 3300006844 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD2 | Metagenome | Rhizosphere |
| 73 | 3300006846 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD4 | Metagenome | Rhizosphere |
| 74 | 3300006847 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD5 | Metagenome | Rhizosphere |
| 75 | 3300006852 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD2 | Metagenome | Rhizosphere |
| 76 | 3300006871 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD3 | Metagenome | Rhizosphere |
| 77 | 3300006880 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD3 | Metagenome | Rhizosphere |
| 78 | 3300006881 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M1-2 | Metagenome | Rhizosphere |
| 79 | 3300006914 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD5 | Metagenome | Rhizosphere |
| 80 | 3300006931 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S2-2 (version 2) (version 2) | Metagenome | Rhizosphere |
| 81 | 3300007076 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD4 | Metagenome | Rhizosphere |
| 82 | 3300009093 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C5-4 metaG | Metagenome | Rhizosphere |
| 83 | 3300009094 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD1 (version 2) (version 2) | Metagenome | Rhizosphere |
| 84 | 3300009098 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M5-4 metaG | Metagenome | Rhizosphere |
| 85 | 3300009101 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-4 metaG | Metagenome | Rhizosphere |
| 86 | 3300009147 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD1 (version 2) (version 2) | Metagenome | Rhizosphere |
| 87 | 3300009148 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M3-4 metaG | Metagenome | Rhizosphere |
| 88 | 3300009174 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C6-4 metaG | Metagenome | Rhizosphere |
| 89 | 3300009176 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M2-4 metaG | Metagenome | Rhizosphere |
| 90 | 3300009177 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-4 metaG | Metagenome | Rhizosphere |
| 91 | 3300009545 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C2-4 metaG | Metagenome | Rhizosphere |
| 92 | 3300009553 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S4-4 metaG | Metagenome | Rhizosphere |
| 93 | 3300011119 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M6-4 metaG | Metagenome | Rhizosphere |
| 94 | 3300013104 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - C3-5 metaG | Metagenome | Rhizosphere |
| 95 | 3300013296 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - M2-5 metaG | Metagenome | Rhizosphere |
| 96 | 3300013306 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - S5-5 metaG | Metagenome | Rhizosphere |
| 97 | 3300013307 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - C5-5 metaG | Metagenome | Rhizosphere |
| 98 | 3300013308 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - M3-5 metaG | Metagenome | Rhizosphere |
| 99 | 3300014325 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - S6-5 metaG | Metagenome | Rhizosphere |
| 100 | 3300014326 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - S3-5 metaG | Metagenome | Rhizosphere |
| 101 | 3300014745 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - M5-5 metaG | Metagenome | Rhizosphere |
| 102 | 3300014968 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - S2-5 metaG | Metagenome | Rhizosphere |
| 103 | 3300014969 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - M4-5 metaG | Metagenome | Rhizosphere |
| 104 | 3300017792 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - S4-5 metaG | Metagenome | Rhizosphere |
| 105 | 3300025315 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA, with PhiX - S5 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 106 | 3300025893 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M6-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 107 | 3300025900 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-4 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 108 | 3300025901 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - M4 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 109 | 3300025903 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 110 | 3300025904 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - C2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 111 | 3300025907 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M5-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 112 | 3300025908 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M6-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 113 | 3300025912 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C8-3B metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 114 | 3300025913 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C5-4 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 115 | 3300025917 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7-3B metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 116 | 3300025918 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-3L metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 117 | 3300025919 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C3-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 118 | 3300025920 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C4-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 119 | 3300025921 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C6-3B metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 120 | 3300025922 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K5-50-2 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 121 | 3300025923 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S5-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 122 | 3300025925 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S6-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 123 | 3300025926 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M4-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 124 | 3300025927 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M5-4 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 125 | 3300025932 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C2-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 126 | 3300025933 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C5-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 127 | 3300025934 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M2-4 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 128 | 3300025935 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M3-4 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 129 | 3300025936 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-3H metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 130 | 3300025937 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M3-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 131 | 3300025938 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M1-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 132 | 3300025939 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - LAR L11-2 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 133 | 3300025940 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M1-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 134 | 3300025941 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-4 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 135 | 3300025942 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M5-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 136 | 3300025944 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7.1-3L metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 137 | 3300025945 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 138 | 3300025949 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C5-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 139 | 3300025960 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M2-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 140 | 3300025961 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S4-4 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 141 | 3300025972 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S4-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 142 | 3300025981 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C4-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 143 | 3300025986 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 144 | 3300026023 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M4-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 145 | 3300026035 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S1-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 146 | 3300026067 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C6-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 147 | 3300026075 | Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K5-10-1 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 148 | 3300026078 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C6-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 149 | 3300026088 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S6-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 150 | 3300026089 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M3-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 151 | 3300026095 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S7-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 152 | 3300026116 | Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C7-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 153 | 3300026118 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S4-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 154 | 3300026121 | Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M7-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 155 | 3300027866 | Populus endosphere microbial communities from Tennessee, USA - Endosphere MetaG P. TD hybrid TD303-3 (SPAdes) (version 2) | Metagenome | Endosphere |
| 156 | 3300027907 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD1 (SPAdes) (version 3) | Metagenome | Rhizosphere |
| 157 | 3300028379 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S1-3 metaG (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 158 | 3300028380 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S5-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 159 | 3300028381 | Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S3-2 (SPAdes) (version 2) | Metagenome | Rhizosphere |
| 160 | 3300031238 | Rhizosphere microbial communities from Carex aquatilis grown in University of Washington, Seatle, WA, United States - 4-19-26 metaG | Metagenome | Rhizosphere |
| 161 | 3300031548 | Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - 322HYB-C-3 | Metagenome | Rhizosphere |
| 162 | 3300031711 | Rhizosphere microbial communities from Carex aquatilis grown in University of Washington, Seatle, WA, United States - 4-1-26 metaG | Metagenome | Rhizosphere |
| 163 | 3300031731 | Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - 322HYB-C-1 | Metagenome | Rhizosphere |
| 164 | 3300031824 | Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - DK15-O-2 | Metagenome | Rhizosphere |
| 165 | 3300031852 | Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - 322HYB-O-3 | Metagenome | Rhizosphere |
| 166 | 3300031903 | Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - 322HYB-O-1 | Metagenome | Rhizosphere |
| 167 | 3300031911 | Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - DK15-C-1 | Metagenome | Rhizosphere |
| 168 | 3300031995 | Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - 322HYB-O-2 | Metagenome | Rhizosphere |
| 169 | 3300032002 | Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - DK15-C-3 | Metagenome | Rhizosphere |
| 170 | 3300032004 | Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - DK15-O-3 | Metagenome | Rhizosphere |
| 171 | 3300032005 | Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - DK15-O-1 | Metagenome | Rhizosphere |
| 172 | 3300032126 | Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - DK15-C-2 | Metagenome | Rhizosphere |
| 173 | 3300034816 | Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_NoN_3 | Metagenome | Rhizosphere |
| 174 | 3300035084 | Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_NoN_1 | Metagenome | Rhizosphere |
| 175 | 3300035088 | Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_NoN_4 | Metagenome | Rhizosphere |
| 176 | 3300035091 | Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_N_4 | Metagenome | Rhizosphere |
| 177 | 3300035111 | Populus rhizosphere microbial communities from soil in Oregon, United States - GW9791_Oregon_NoN_11 | Metagenome | Rhizosphere |
| 178 | 3300035112 | Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_NoN_16 | Metagenome | Rhizosphere |
| 179 | 3300035114 | Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_NoN_3 | Metagenome | Rhizosphere |
| 180 | 3300035115 | Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_NoN_11 | Metagenome | Rhizosphere |
| 181 | 3300035170 | Populus rhizosphere microbial communities from soil in Oregon, United States - GW9791_Oregon_N_1 | Metagenome | Rhizosphere |
| 182 | 3300035172 | Populus rhizosphere microbial communities from soil in Oregon, United States - WV94_Oregon_N_3 | Metagenome | Rhizosphere |
| 183 | 3300035241 | Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_N_4 | Metagenome | Rhizosphere |
| 184 | 3300035242 | Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_N_11 | Metagenome | Rhizosphere |
| 185 | 3300035410 | Populus rhizosphere microbial communities from soil in Oregon, United States - GW9791_Oregon_NoN_12 | Metagenome | Rhizosphere |
| 186 | 3300035691 | Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_NoN_4 | Metagenome | Rhizosphere |
| 187 | 3300035692 | Populus rhizosphere microbial communities from soil in Oregon, United States - WV94_Oregon_NoN_11 | Metagenome | Rhizosphere |
| 188 | 3300035695 | Populus rhizosphere microbial communities from soil in Oregon, United States - GW9791_Oregon_NoN_19 | Metagenome | Rhizosphere |
| 189 | 3300035724 | Populus rhizosphere microbial communities from soil in Oregon, United States - WV94_Oregon_NoN_1 | Metagenome | Rhizosphere |
| 190 | 3300036401 | Populus rhizosphere microbial communities from soil in Oregon, United States - WV94_Oregon_NoN_16 | Metagenome | Rhizosphere |
| 191 | 3300037068 | Populus rhizosphere microbial communities from soil in Oregon, United States - GW9791_Oregon_NoN_16 | Metagenome | Rhizosphere |
| 192 | 3300042007 | Rhizosphere microbial communities from Sorghum plant, Scottsbluff, Nebraska, USA - SB0612DE14Z070717_5290 | Metagenome | Rhizosphere |
| 193 | 3300042436 | Rhizosphere microbial communities from Sorghum plant, Central City, Nebraska, USA - CC0113LE14Z081617_5520 | Metagenome | Rhizosphere |
| 194 | 3300042439 | Rhizosphere microbial communities from Sorghum plant, Central City, Nebraska, USA - CC0612FE14Z071817_5363 | Metagenome | Rhizosphere |
| 195 | 3300042461 | Rhizosphere microbial communities from Sorghum plant, Central City, Nebraska, USA - CC0612LE14Z071817_5366 | Metagenome | Rhizosphere |
| 196 | 3300042993 | Rhizosphere microbial communities from Sorghum plant, Central City, Nebraska, USA - CC0821LE14Z071817_5372 | Metagenome | Rhizosphere |
| 197 | 3300045051 | Rhizosphere soil microbial communities from rice plant in Newark, Delaware, United States - Rhiz_9BH_GED | Metagenome | Rhizosphere |
| 198 | 3300046455 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-307-CL1_26_33 rhizosphere | Metagenome | Rhizosphere |
| 199 | 3300046459 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-448-CL3_88_32 rhizosphere | Metagenome | Rhizosphere |
| 200 | 3300046472 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-13-CL1_35_33 rhizosphere | Metagenome | Rhizosphere |
| 201 | 3300046473 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-13-CL3_85_26 rhizosphere | Metagenome | Rhizosphere |
| 202 | 3300046491 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-13-Co2_41_23 rhizosphere | Metagenome | Rhizosphere |
| 203 | 3300046499 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-234-CL1_24_28 rhizosphere | Metagenome | Rhizosphere |
| 204 | 3300046511 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-331-CL2_55_18 rhizosphere | Metagenome | Rhizosphere |
| 205 | 3300046516 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-448-CL1_35_3 rhizosphere | Metagenome | Rhizosphere |
| 206 | 3300046517 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-470-CL2_38_23 rhizosphere | Metagenome | Rhizosphere |
| 207 | 3300046522 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-845-Co2_60_28 rhizosphere | Metagenome | Rhizosphere |
| 208 | 3300046525 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-360-Co1_23_6 rhizosphere | Metagenome | Rhizosphere |
| 209 | 3300046528 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-845-Co1_24_3 rhizosphere | Metagenome | Rhizosphere |
| 210 | 3300046533 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-845-CL2_37_16 rhizosphere | Metagenome | Rhizosphere |
| 211 | 3300046535 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-133-CL1_28_16 rhizosphere | Metagenome | Rhizosphere |
| 212 | 3300046536 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-133-CL2_62_7 rhizosphere | Metagenome | Rhizosphere |
| 213 | 3300046537 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-234-Co3_21_62 rhizosphere | Metagenome | Rhizosphere |
| 214 | 3300046538 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-331-Co1_12_7 rhizosphere | Metagenome | Rhizosphere |
| 215 | 3300046539 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-360-Co3_13_34 rhizosphere | Metagenome | Rhizosphere |
| 216 | 3300046543 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-847-CL1_28_5 rhizosphere | Metagenome | Rhizosphere |
| 217 | 3300046664 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-904-Co1_5_9 rhizosphere | Metagenome | Rhizosphere |
| 218 | 3300046678 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-258-CL1_34_5 rhizosphere | Metagenome | Rhizosphere |
| 219 | 3300046683 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-904-CL3_91_3 rhizosphere | Metagenome | Rhizosphere |
| 220 | 3300046684 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - GW-4579-Co2_44_8 rhizosphere | Metagenome | Rhizosphere |
| 221 | 3300046689 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-351-CL2_54_28 rhizosphere | Metagenome | Rhizosphere |
| 222 | 3300046691 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - GW-4579-Co3_14_51 rhizosphere | Metagenome | Rhizosphere |
| 223 | 3300046809 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-258-CL2_67_23 rhizosphere | Metagenome | Rhizosphere |
| 224 | 3300047317 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-307-CL2_57_8 rhizosphere | Metagenome | Rhizosphere |
| 225 | 3300047318 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-833-Co1_6_4 rhizosphere | Metagenome | Rhizosphere |
| 226 | 3300047319 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - GW-9591-CL1_34_16 rhizosphere | Metagenome | Rhizosphere |
| 227 | 3300047445 | Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - GW-9591-Co1_16_8 rhizosphere | Metagenome | Rhizosphere |
| 228 | 3300047471 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - SKWD-24-1-CL2_58_25 rhizosphere | Metagenome | Rhizosphere |
| 229 | 3300048903 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR rhizoplane_7v unlabeled | Metagenome | Rhizoplane |
| 230 | 3300048904 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR rhizoplane_7w unlabeled | Metagenome | Rhizoplane |
| 231 | 3300048905 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR rhizoplane_1c N15 | Metagenome | Rhizoplane |
| 232 | 3300048907 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR rhizoplane_2c N15 | Metagenome | Rhizoplane |
| 233 | 3300048908 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR rhizoplane_2d N15 | Metagenome | Rhizoplane |
| 234 | 3300048909 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR rhizoplane_3c N15 | Metagenome | Rhizoplane |
| 235 | 3300048910 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR rhizoplane_3d N15 | Metagenome | Rhizoplane |
| 236 | 3300048911 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_8v unlabeled | Metagenome | Rhizoplane |
| 237 | 3300048912 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_8w unlabeled | Metagenome | Rhizoplane |
| 238 | 3300048913 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_4c N15 | Metagenome | Rhizoplane |
| 239 | 3300048914 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_4d N15 | Metagenome | Rhizoplane |
| 240 | 3300048915 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_5c N15 | Metagenome | Rhizoplane |
| 241 | 3300048916 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_5d N15 | Metagenome | Rhizoplane |
| 242 | 3300048917 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_6c N15 | Metagenome | Rhizoplane |
| 243 | 3300048918 | Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_6d N15 | Metagenome | Rhizoplane |
| 244 | 3300049571 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L1_TR_GHRAS_01 | Metagenome | Rhizosphere |
| 245 | 3300049572 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L1_TR_GHRAS_03 | Metagenome | Rhizosphere |
| 246 | 3300049574 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L2_TR_GHRAS_02 | Metagenome | Rhizosphere |
| 247 | 3300049575 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L2_TR_GHRAS_03 | Metagenome | Rhizosphere |
| 248 | 3300049576 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L3_TR_GHRAS_01 | Metagenome | Rhizosphere |
| 249 | 3300049577 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L3_TR_GHRAS_02 | Metagenome | Rhizosphere |
| 250 | 3300049578 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L3_TR_GHRAS_03 | Metagenome | Rhizosphere |
| 251 | 3300049579 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L4_TR_GHRAS_01 | Metagenome | Rhizosphere |
| 252 | 3300049580 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L5_TR_GHRAS_01 | Metagenome | Rhizosphere |
| 253 | 3300049581 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L5_TR_GHRAS_02 | Metagenome | Rhizosphere |
| 254 | 3300049582 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L5_TR_GHRAS_03 | Metagenome | Rhizosphere |
| 255 | 3300049584 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - WT_T2_FRAS_02 | Metagenome | Rhizosphere |
| 256 | 3300049587 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L1_T2_FRAS_02 | Metagenome | Rhizosphere |
| 257 | 3300049588 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L1_T2_FRAS_03 | Metagenome | Rhizosphere |
| 258 | 3300049589 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L2_T2_FRAS_01 | Metagenome | Rhizosphere |
| 259 | 3300049590 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L2_T2_FRAS_02 | Metagenome | Rhizosphere |
| 260 | 3300049591 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L2_T2_FRAS_03 | Metagenome | Rhizosphere |
| 261 | 3300049592 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L3_T2_FRAS_01 | Metagenome | Rhizosphere |
| 262 | 3300049593 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L3_T2_FRAS_02 | Metagenome | Rhizosphere |
| 263 | 3300049741 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L4_T2_FRAS_01 | Metagenome | Rhizosphere |
| 264 | 3300049742 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L4_T2_FRAS_02 | Metagenome | Rhizosphere |
| 265 | 3300049743 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L4_T2_FRAS_03 | Metagenome | Rhizosphere |
| 266 | 3300049779 | Panicgrass rhizosphere microbial communities from growth chamber in LBNL, Berkeley, California, USA - C22_A_7_drought | Metagenome | Rhizosphere |
| 267 | 3300049822 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L1_TR_GHRAS_02 | Metagenome | Rhizosphere |
| 268 | 3300049823 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L4_TR_GHRAS_02 | Metagenome | Rhizosphere |
| 269 | 3300049824 | Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L4_TR_GHRAS_03 | Metagenome | Rhizosphere |
| 270 | 3300050491 | Populus endosphere microbial communities from Tennessee, USA - Endosphere MetaG P. deltoides DD176-4 re-annotation | Metagenome | Endosphere |
| 271 | 3300050492 | Populus endosphere microbial communities from Tennessee, USA - Endosphere MetaG P. deltoides DD176-5 re-annotation | Metagenome | Endosphere |
| 272 | 3300050493 | Populus endosphere microbial communities from Tennessee, USA - Endosphere MetaG P. TD hybrid TD303-1 re-annotation | Metagenome | Endosphere |
| 273 | 3300050495 | Populus endosphere microbial communities from Tennessee, USA - Endosphere MetaG P. TD hybrid TD303-3 re-annotation | Metagenome | Endosphere |
| 274 | 3300050507 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD1 re-annotation | Metagenome | Rhizosphere |
| 275 | 3300050508 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD3 re-annotation | Metagenome | Rhizosphere |
| 276 | 3300050509 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD4 re-annotation | Metagenome | Rhizosphere |
| 277 | 3300050510 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD5 re-annotation | Metagenome | Rhizosphere |
| 278 | 3300050511 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD1 re-annotation | Metagenome | Rhizosphere |
| 279 | 3300050512 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD3 re-annotation | Metagenome | Rhizosphere |
| 280 | 3300050513 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD4 re-annotation | Metagenome | Rhizosphere |
| 281 | 3300050514 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD5 re-annotation | Metagenome | Rhizosphere |
| 282 | 3300050515 | Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD2 re-annotation | Metagenome | Rhizosphere |
| 283 | 3300053077 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-285-CL1_33_12 rhizosphere | Metagenome | Rhizosphere |
| 284 | 3300053084 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-234-CL2_65_22 rhizosphere | Metagenome | Rhizosphere |
| 285 | 3300053085 | Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-360-CL3_72_12 rhizosphere | Metagenome | Rhizosphere |
| 286 | 3300053103 | Root microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-13-Co1_30_3 endosphere | Metagenome | Endosphere |
| 287 | 3300054114 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L5_T2_FRAS_03 | Metagenome | Rhizosphere |
| 288 | 3300059421 | Rhizosphere soil microbial communities from sorghum plant in University of Arizona Maricopa Agricultural Center, AZ, USA - 6_0-15_MAC_RHIZO_20210810 | Metagenome | Rhizosphere |
| 289 | 3300059423 | Rhizosphere soil microbial communities from sorghum plant in University of Arizona Maricopa Agricultural Center, AZ, USA - 8_0-15_MAC_RHIZO_20210810 | Metagenome | Rhizosphere |
| 290 | 3300059424 | Rhizosphere soil microbial communities from sorghum plant in University of Arizona Maricopa Agricultural Center, AZ, USA - 10_0-15_MAC_RHIZO_20210810 | Metagenome | Rhizosphere |
| 291 | 3300059426 | Rhizosphere soil microbial communities from sorghum plant in University of Arizona Maricopa Agricultural Center, AZ, USA - 11_0-15_MAC_RHIZO_20210810 | Metagenome | Rhizosphere |
| 292 | 3300060353 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L5_T2_FRAS_01 | Metagenome | Rhizosphere |
| 293 | 3300061734 | Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L3_T2_FRAS_03 (v2) (version 2) | Metagenome | Rhizosphere |
Type Distribution
| Type | Percentage (%) |
|---|---|
| Metagenomes | 100 |
| Metatranscriptomes | 0 |
| Isolates | 0 |
Biome Distribution
| Category | Percentage (%) |
|---|---|
| Aerial Root | 0 |
| Bulb | 0 |
| Endosphere | 1.22 |
| Nodule | 0 |
| Rhizoplane | 3.2 |
| Rhizosphere | 95.58 |
| Stem | 0 |
| Stem Tuber | 0 |
| Unclassified | 0 |
Taxonomy
Scaffolds
Family Sequences
Functional Annotation
PFAM ID
Name
Description
Start Position
End Position
Accuracy
Structural Annotation
Top 5 Hits
| ID | Description | Score | Start | End |
|---|---|---|---|---|
| 4l5e-assembly1.cif.gz_A-2 | crystal structure of a. aeolicus ntrc1 dna binding domain | 0.9821 | 378 | 420 |
| 5ds9-assembly1.cif.gz_A | crystal structure of fis bound to 27bp dna f1-8a (aaattagtttgaattttgagctaattt) | 0.9619 | 379 | 422 |
| 6p0s-assembly1.cif.gz_B | "crystal structure of ternary dna complex ""fx2"" containing e. coli fis and phage lambda xis" | 0.9589 | 379 | 422 |
| 1etq-assembly1.cif.gz_B | the crystal structure of e. coli fis mutant r71y | 0.9561 | 379 | 422 |
| 5ds9-assembly1.cif.gz_B | crystal structure of fis bound to 27bp dna f1-8a (aaattagtttgaattttgagctaattt) | 0.955 | 379 | 422 |
| ID | Description | Score | Start | End | Superfamily |
|---|---|---|---|---|---|
| 4l5eA00 | Mainly Alpha;Orthogonal Bundle;Arc Repressor Mutant, subunit A;Homeodomain-like | 0.9821 | 378 | 420 | 1.10.10.60 |
| 3e7lC00 | Mainly Alpha;Orthogonal Bundle;Arc Repressor Mutant, subunit A;Homeodomain-like | 0.972 | 380 | 422 | 1.10.10.60 |
| 3jriB00 | Mainly Alpha;Orthogonal Bundle;Arc Repressor Mutant, subunit A;Homeodomain-like | 0.9706 | 379 | 422 | 1.10.10.60 |
| 4fthB00 | Mainly Alpha;Orthogonal Bundle;Arc Repressor Mutant, subunit A;Homeodomain-like | 0.9704 | 380 | 422 | 1.10.10.60 |
| 3fisA00 | Mainly Alpha;Orthogonal Bundle;Arc Repressor Mutant, subunit A;Homeodomain-like | 0.9664 | 379 | 420 | 1.10.10.60 |
| ID | Description | Score | Start | End | GO Terms |
|---|---|---|---|---|---|
| AF-A0A352EA18-F1-model_v4 | deleted | 0.893 | 123 | 361 |
|
| AF-A0A2L2N8A4-F1-model_v4 | Acetoacetate metabolism regulatory protein AtoC | 0.8894 | 118 | 361 |
GO:0000160
GO:0005524 GO:0006355 GO:0016887 |
| AF-A0A538Q3Z9-F1-model_v4 | AAA family ATPase | 0.8849 | 123 | 360 |
GO:0003677
GO:0005524 GO:0006355 GO:0016887 |
| AF-A0A7W0V0C3-F1-model_v4 | Sigma-54 factor interaction domain-containing protein | 0.8761 | 118 | 290 |
GO:0005524
GO:0006355 GO:0016887 |
| AF-A0A850NXH2-F1-model_v4 | Sigma-54 factor interaction domain-containing protein | 0.8738 | 123 | 308 |
GO:0003677
GO:0005524 GO:0006355 GO:0016887 GO:0032508 |