F390763

General Info

Members Datasets Scaffolds Average Seq Length
292 181 584 339

Family's Representative Sequence

Representative Sequence 3300005364|Ga0070673_100105964|Ga0070673_1001059641
Length 371
Sequence MTSITMDSIVVGQSARMRAVFEFLRIIGNSDSTVLVTGESGTGKEVTATLVHQSSRRSHRPFVAVSCALFSETLIESELFGHERGAFTGAIKDRPGRFELAESGTIFLDDIDDVPLSMQVKLLRVLQNRTVERLGGTRAIPVNVRVIAGTKRDLKQLVADGKFREDLFYRLNVLPVSLPPLRERPEDIPVLMEHFLQRYFRRRGEGVPPISDAVKQGFMRYSWPGNVRELENACERIAQTCSCGTVRVCCMPANVLFHAGREPVPAMAPLAPPVPELHVGSSEAAAHVPVAAVPAAAGVAPRPGPASQMIGAATAAGEVPISLDDRLKEVEANLITWALQASAGNKSKAAELLHVKRSTLGDRIARCGLGR

Samples

Sample ID Description Type Environment
1 3300005364 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M2-3 metaG Metagenome Rhizosphere
2 3300003203 Tabebuia heterophylla rhizosphere microbial communities from the University of Puerto Rico - S4T2R2 Metagenome Rhizosphere
3 3300005289 Switchgrass rhizosphere bacterial communities from Rose Lake, Michigan, USA - RL2 v2 (version 2) Metagenome Rhizosphere
4 3300005290 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, MSU, sample Rhizosphere Soil Replicate 1: eDNA_1 v3 (version 3) Metagenome Rhizosphere
5 3300005293 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, MSU, sample Bulk Soil Replicate 1 : eDNA_1 v2 (version 2) Metagenome Rhizosphere
6 3300005329 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7.1-3L metaG Metagenome Rhizosphere
7 3300005330 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-3H metaG Metagenome Rhizosphere
8 3300005331 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S6-3 metaG Metagenome Rhizosphere
9 3300005335 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-3 metaG Metagenome Rhizosphere
10 3300005341 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-10-1 metaG Metagenome Rhizosphere
11 3300005347 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S4-3 metaG Metagenome Rhizosphere
12 3300005353 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S5-3 metaG Metagenome Rhizosphere
13 3300005354 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M4-3 metaG Metagenome Rhizosphere
14 3300005355 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S7-3 metaG Metagenome Rhizosphere
15 3300005356 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M3-3 metaG Metagenome Rhizosphere
16 3300005365 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S1-3H metaG Metagenome Rhizosphere
17 3300005435 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - LAR L8-3 metaG Metagenome Rhizosphere
18 3300005441 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K5-10-1 metaG Metagenome Rhizosphere
19 3300005444 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-25-1 metaG Metagenome Rhizosphere
20 3300005456 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M7-3 metaG Metagenome Rhizosphere
21 3300005457 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C5-3 metaG Metagenome Rhizosphere
22 3300005459 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M3-2 Metagenome Rhizosphere
23 3300005518 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-50-3 metaG Metagenome Rhizosphere
24 3300005535 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7.2-3L metaG Metagenome Rhizosphere
25 3300005543 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M1-3 metaG Metagenome Rhizosphere
26 3300005544 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-3L metaG Metagenome Rhizosphere
27 3300005545 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-25-2 metaG Metagenome Rhizosphere
28 3300005547 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K1-10-3 metaG Metagenome Rhizosphere
29 3300005549 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K5-25-2 metaG Metagenome Rhizosphere
30 3300005564 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7-3 metaG Metagenome Rhizosphere
31 3300005577 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C7-2 Metagenome Rhizosphere
32 3300005578 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C4-2 Metagenome Rhizosphere
33 3300005615 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K5-10-3 metaG Metagenome Rhizosphere
34 3300005616 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C2-2 Metagenome Rhizosphere
35 3300005617 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S2-2 Metagenome Rhizosphere
36 3300005718 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M2-2 Metagenome Rhizosphere
37 3300005719 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S4-2 Metagenome Rhizosphere
38 3300005840 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M6-2 Metagenome Rhizosphere
39 3300005841 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S6-2 Metagenome Rhizosphere
40 3300005842 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S1-2 Metagenome Rhizosphere
41 3300005843 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S3-2 Metagenome Rhizosphere
42 3300005844 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S5-2 Metagenome Rhizosphere
43 3300005985 Tabebuia heterophylla rhizosphere microbial communities from the University of Puerto Rico - S4T2R2 Metagenome Rhizosphere
44 3300006173 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - LAR L11-2 metaG Metagenome Rhizosphere
45 3300006358 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M7-2 Metagenome Rhizosphere
46 3300006844 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD2 Metagenome Rhizosphere
47 3300006847 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD5 Metagenome Rhizosphere
48 3300006852 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD2 Metagenome Rhizosphere
49 3300006871 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD3 Metagenome Rhizosphere
50 3300006881 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M1-2 Metagenome Rhizosphere
51 3300006914 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD5 Metagenome Rhizosphere
52 3300006931 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S2-2 (version 2) (version 2) Metagenome Rhizosphere
53 3300007076 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD4 Metagenome Rhizosphere
54 3300009094 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD1 (version 2) (version 2) Metagenome Rhizosphere
55 3300009098 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M5-4 metaG Metagenome Rhizosphere
56 3300009101 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-4 metaG Metagenome Rhizosphere
57 3300009147 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD1 (version 2) (version 2) Metagenome Rhizosphere
58 3300009176 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M2-4 metaG Metagenome Rhizosphere
59 3300009177 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-4 metaG Metagenome Rhizosphere
60 3300009553 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S4-4 metaG Metagenome Rhizosphere
61 3300013296 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - M2-5 metaG Metagenome Rhizosphere
62 3300013297 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - M6-5 metaG Metagenome Rhizosphere
63 3300013306 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - S5-5 metaG Metagenome Rhizosphere
64 3300014325 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - S6-5 metaG Metagenome Rhizosphere
65 3300025315 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA, with PhiX - S5 (SPAdes) (version 2) Metagenome Rhizosphere
66 3300025893 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M6-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
67 3300025899 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M2-2 (SPAdes) (version 2) Metagenome Rhizosphere
68 3300025900 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-4 metaG (SPAdes) (version 2) Metagenome Rhizosphere
69 3300025903 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S2-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
70 3300025907 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M5-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
71 3300025908 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M6-2 (SPAdes) (version 2) Metagenome Rhizosphere
72 3300025911 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C6-4 metaG (SPAdes) (version 2) Metagenome Rhizosphere
73 3300025918 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-3L metaG (SPAdes) (version 2) Metagenome Rhizosphere
74 3300025923 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S5-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
75 3300025925 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S6-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
76 3300025926 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M4-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
77 3300025927 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M5-4 metaG (SPAdes) (version 2) Metagenome Rhizosphere
78 3300025928 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - LAR L8-2 metaG (SPAdes) (version 2) Metagenome Rhizosphere
79 3300025929 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - LAR L8-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
80 3300025931 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S7-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
81 3300025932 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C2-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
82 3300025933 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C5-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
83 3300025934 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M2-4 metaG (SPAdes) (version 2) Metagenome Rhizosphere
84 3300025935 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M3-4 metaG (SPAdes) (version 2) Metagenome Rhizosphere
85 3300025937 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M3-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
86 3300025938 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M1-2 (SPAdes) (version 2) Metagenome Rhizosphere
87 3300025940 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M1-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
88 3300025941 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-4 metaG (SPAdes) (version 2) Metagenome Rhizosphere
89 3300025942 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M5-2 (SPAdes) (version 2) Metagenome Rhizosphere
90 3300025944 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7.1-3L metaG (SPAdes) (version 2) Metagenome Rhizosphere
91 3300025945 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C7-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
92 3300025960 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS M2-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
93 3300025961 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S4-4 metaG (SPAdes) (version 2) Metagenome Rhizosphere
94 3300025972 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S4-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
95 3300025981 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C4-2 (SPAdes) (version 2) Metagenome Rhizosphere
96 3300025986 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S3-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
97 3300026023 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M4-2 (SPAdes) (version 2) Metagenome Rhizosphere
98 3300026035 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S1-2 (SPAdes) (version 2) Metagenome Rhizosphere
99 3300026067 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS C6-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
100 3300026075 Corn, switchgrass and miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS K5-10-1 metaG (SPAdes) (version 2) Metagenome Rhizosphere
101 3300026088 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S6-2 (SPAdes) (version 2) Metagenome Rhizosphere
102 3300026089 Miscanthus rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Miscanthus M3-2 (SPAdes) (version 2) Metagenome Rhizosphere
103 3300026116 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C7-2 (SPAdes) (version 2) Metagenome Rhizosphere
104 3300026118 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S4-2 (SPAdes) (version 2) Metagenome Rhizosphere
105 3300026142 Corn rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Corn C2-2 (SPAdes) (version 2) Metagenome Rhizosphere
106 3300027907 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD1 (SPAdes) (version 3) Metagenome Rhizosphere
107 3300028379 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS S1-3 metaG (SPAdes) (version 2) Metagenome Rhizosphere
108 3300028380 Switchgrass rhizosphere microbial communities from Kellogg Biological Station, Michigan, USA - KBS Switchgrass S5-2 (SPAdes) (version 2) Metagenome Rhizosphere
109 3300031548 Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - 322HYB-C-3 Metagenome Rhizosphere
110 3300031711 Rhizosphere microbial communities from Carex aquatilis grown in University of Washington, Seatle, WA, United States - 4-1-26 metaG Metagenome Rhizosphere
111 3300031728 Rhizosphere microbial communities from salt marsh grasses in Alabama, United States - J0-2_160517rDrC Metagenome Rhizosphere
112 3300031731 Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - 322HYB-C-1 Metagenome Rhizosphere
113 3300031824 Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - DK15-O-2 Metagenome Rhizosphere
114 3300031852 Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - 322HYB-O-3 Metagenome Rhizosphere
115 3300031995 Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - 322HYB-O-2 Metagenome Rhizosphere
116 3300032004 Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - DK15-O-3 Metagenome Rhizosphere
117 3300032005 Maize rhizosphere microbial communities from greenhouse at UC Davis, California, United States - DK15-O-1 Metagenome Rhizosphere
118 3300034816 Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_NoN_3 Metagenome Rhizosphere
119 3300034817 Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_N_1 Metagenome Rhizosphere
120 3300034818 Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_N_3 Metagenome Rhizosphere
121 3300034819 Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_N_1 Metagenome Rhizosphere
122 3300034820 Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_N_2 Metagenome Rhizosphere
123 3300034957 Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_NoN_2 Metagenome Rhizosphere
124 3300035085 Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_NoN_2 Metagenome Rhizosphere
125 3300035088 Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_NoN_4 Metagenome Rhizosphere
126 3300035090 Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_N_2 Metagenome Rhizosphere
127 3300035092 Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_N_11 Metagenome Rhizosphere
128 3300035112 Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_NoN_16 Metagenome Rhizosphere
129 3300035114 Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_NoN_3 Metagenome Rhizosphere
130 3300035115 Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_NoN_11 Metagenome Rhizosphere
131 3300035121 Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_N_3 Metagenome Rhizosphere
132 3300035207 Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_NoN_16 Metagenome Rhizosphere
133 3300035242 Populus rhizosphere microbial communities from soil in West Virginia, United States - WV94_WV_N_11 Metagenome Rhizosphere
134 3300035691 Populus rhizosphere microbial communities from soil in West Virginia, United States - GW9791_WV_NoN_4 Metagenome Rhizosphere
135 3300036401 Populus rhizosphere microbial communities from soil in Oregon, United States - WV94_Oregon_NoN_16 Metagenome Rhizosphere
136 3300042001 Rhizosphere microbial communities from Sorghum plant, Central City, Nebraska, USA - CC0512LE14Z081617_5542 Metagenome Rhizosphere
137 3300042436 Rhizosphere microbial communities from Sorghum plant, Central City, Nebraska, USA - CC0113LE14Z081617_5520 Metagenome Rhizosphere
138 3300044712 Rhizosphere soil microbial communities from rice plants in Newark, Delaware, United States - Rhiz_9IH_GED Metagenome Rhizosphere
139 3300045051 Rhizosphere soil microbial communities from rice plant in Newark, Delaware, United States - Rhiz_9BH_GED Metagenome Rhizosphere
140 3300046477 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - GW-11047-CL1_23_5 rhizosphere Metagenome Rhizosphere
141 3300046543 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-847-CL1_28_5 rhizosphere Metagenome Rhizosphere
142 3300047318 Rhizosphere soil microbial communities from poplar common garden site in Corvallis, Oregon, USA - BESC-833-Co1_6_4 rhizosphere Metagenome Rhizosphere
143 3300048088 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-285-CL2_56_7 rhizosphere Metagenome Rhizosphere
144 3300048905 Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR rhizoplane_1c N15 Metagenome Rhizoplane
145 3300048907 Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - CIR rhizoplane_2c N15 Metagenome Rhizoplane
146 3300048911 Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_8v unlabeled Metagenome Rhizoplane
147 3300048912 Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_8w unlabeled Metagenome Rhizoplane
148 3300048913 Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_4c N15 Metagenome Rhizoplane
149 3300048914 Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_4d N15 Metagenome Rhizoplane
150 3300048915 Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_5c N15 Metagenome Rhizoplane
151 3300048916 Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_5d N15 Metagenome Rhizoplane
152 3300048917 Rhizoplane soil microbial communities from switchgrass plant in W.K. Kellogg Biological Station, Michigan, USA - KLW rhizoplane_6c N15 Metagenome Rhizoplane
153 3300049570 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - WT_TR_GHRAS_03 Metagenome Rhizosphere
154 3300049572 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L1_TR_GHRAS_03 Metagenome Rhizosphere
155 3300049575 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L2_TR_GHRAS_03 Metagenome Rhizosphere
156 3300049576 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L3_TR_GHRAS_01 Metagenome Rhizosphere
157 3300049577 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L3_TR_GHRAS_02 Metagenome Rhizosphere
158 3300049579 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L4_TR_GHRAS_01 Metagenome Rhizosphere
159 3300049580 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L5_TR_GHRAS_01 Metagenome Rhizosphere
160 3300049587 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L1_T2_FRAS_02 Metagenome Rhizosphere
161 3300049588 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L1_T2_FRAS_03 Metagenome Rhizosphere
162 3300049590 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L2_T2_FRAS_02 Metagenome Rhizosphere
163 3300049591 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L2_T2_FRAS_03 Metagenome Rhizosphere
164 3300049592 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L3_T2_FRAS_01 Metagenome Rhizosphere
165 3300049741 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L4_T2_FRAS_01 Metagenome Rhizosphere
166 3300049742 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L4_T2_FRAS_02 Metagenome Rhizosphere
167 3300049743 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L4_T2_FRAS_03 Metagenome Rhizosphere
168 3300049822 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L1_TR_GHRAS_02 Metagenome Rhizosphere
169 3300049824 Sugarcane rhizosphere microbial communities from a greenhouse in University of Florida, Reddick, FL, USA - L4_TR_GHRAS_03 Metagenome Rhizosphere
170 3300050507 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD1 re-annotation Metagenome Rhizosphere
171 3300050508 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD3 re-annotation Metagenome Rhizosphere
172 3300050510 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. deltoides SRZDD5 re-annotation Metagenome Rhizosphere
173 3300050511 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD1 re-annotation Metagenome Rhizosphere
174 3300050512 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD3 re-annotation Metagenome Rhizosphere
175 3300050513 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD4 re-annotation Metagenome Rhizosphere
176 3300050514 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD5 re-annotation Metagenome Rhizosphere
177 3300050515 Populus rhizosphere microbial communities from Tennessee, USA - Rhizosphere MetaG P. TD hybrid SRZTD2 re-annotation Metagenome Rhizosphere
178 3300053084 Rhizosphere soil microbial communities from poplar common garden site in Clatskanie, Oregon, USA - BESC-234-CL2_65_22 rhizosphere Metagenome Rhizosphere
179 3300053134 Root microbial communities from poplar common garden site in Corvallis, Oregon, USA - SKWD-24-1-Co1_7_5 endosphere Metagenome Endosphere
180 3300054114 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L5_T2_FRAS_03 Metagenome Rhizosphere
181 3300061734 Sugarcane rhizosphere microbial communities from experimental field in University of Florida, Reddick, FL, USA - L3_T2_FRAS_03 (v2) (version 2) Metagenome Rhizosphere

Type Distribution

Type Percentage (%)
Metagenomes 100
Metatranscriptomes 0
Isolates 0

Biome Distribution

Category Percentage (%)
Aerial Root 0
Bulb 0
Endosphere 0.34
Nodule 0
Rhizoplane 5.48
Rhizosphere 94.18
Stem 0
Stem Tuber 0
Unclassified 0

Taxonomy

Scaffolds

Scaffold Dataset Taxonomy Length
1 Ga0070673_100105964 3300005364 Bacteria 2323
2 JGI25406J46586_10054776 3300003203 Bacteria 1317
3 Ga0065704_10115870 3300005289 Bacteria 1864
4 Ga0065712_10072533 3300005290 Bacteria 4704
5 Ga0065715_10048986 3300005293 Bacteria 1307
6 Ga0065715_10095372 3300005293 Bacteria 4099
7 Ga0065715_10133082 3300005293 Bacteria 1974
8 Ga0070683_100005494 3300005329 Bacteria 10590
9 Ga0070690_100021987 3300005330 Bacteria 3900
10 Ga0070670_100009020 3300005331 Bacteria 8520
11 Ga0070670_100024842 3300005331 Bacteria 5155
12 Ga0070666_10017764 3300005335 Bacteria 4564
13 Ga0070666_10097592 3300005335 Bacteria 2023
14 Ga0070691_10006554 3300005341 Bacteria 5325
15 Ga0070668_100162450 3300005347 Bacteria 1813
16 Ga0070668_100348399 3300005347 Bacteria 1253
17 Ga0070669_100004509 3300005353 Bacteria 10048
18 Ga0070675_100000325 3300005354 Bacteria 32228
19 Ga0070671_100007245 3300005355 Bacteria 8862
20 Ga0070671_100007833 3300005355 Bacteria 8536
21 Ga0070671_100022907 3300005355 Bacteria 5104
22 Ga0070671_100385058 3300005355 Bacteria 1199
23 Ga0070674_100013923 3300005356 Bacteria 4987
24 Ga0070674_100110481 3300005356 Bacteria 2018
25 Ga0070673_100354581 3300005364 Bacteria 1303
26 Ga0070688_100002711 3300005365 Bacteria 8983
27 Ga0070714_100019836 3300005435 Bacteria 5484
28 Ga0070700_100007835 3300005441 Bacteria 5791
29 Ga0070700_100199101 3300005441 Bacteria 1406
30 Ga0070694_100065523 3300005444 Bacteria 2489
31 Ga0070678_100125006 3300005456 Bacteria 2034
32 Ga0070662_100431829 3300005457 Bacteria 1091
33 Ga0068867_100103630 3300005459 Bacteria 2176
34 Ga0070699_100041767 3300005518 Bacteria 3969
35 Ga0070684_100000445 3300005535 Bacteria 28285
36 Ga0070672_100083811 3300005543 Bacteria 2559
37 Ga0070672_100179842 3300005543 Bacteria 1762
38 Ga0070686_100001255 3300005544 Bacteria 14390
39 Ga0070686_100064482 3300005544 Bacteria 2376
40 Ga0070695_100006096 3300005545 Bacteria 7125
41 Ga0070693_100041530 3300005547 Bacteria 2588
42 Ga0070693_100043910 3300005547 Bacteria 2526
43 Ga0070704_100091565 3300005549 Bacteria 2268
44 Ga0070664_100001199 3300005564 Bacteria 20647
45 Ga0070664_100263152 3300005564 Bacteria 1552
46 Ga0068857_100012578 3300005577 Bacteria 7373
47 Ga0068857_100116278 3300005577 Bacteria 2406
48 Ga0068854_100016279 3300005578 Bacteria 4954
49 Ga0068854_100025271 3300005578 Bacteria 4075
50 Ga0068854_100317039 3300005578 Bacteria 1266
51 Ga0070702_100174417 3300005615 Bacteria 1401
52 Ga0068852_100055584 3300005616 Bacteria 3417
53 Ga0068859_100043815 3300005617 Bacteria 4497
54 Ga0068859_100102901 3300005617 Bacteria 2914
55 Ga0068859_100224682 3300005617 Bacteria 1966
56 Ga0068866_10079892 3300005718 Bacteria 1753
57 Ga0068861_100052236 3300005719 Bacteria 3106
58 Ga0068861_100289545 3300005719 Bacteria 1414
59 Ga0068870_10147615 3300005840 Bacteria 1382
60 Ga0068863_100006072 3300005841 Bacteria 11855
61 Ga0068858_100015446 3300005842 Bacteria 7180
62 Ga0068860_100308410 3300005843 Bacteria 1552
63 Ga0068862_100017032 3300005844 Bacteria 6046
64 Ga0068862_100028794 3300005844 Bacteria 4678
65 Ga0068862_100137200 3300005844 Bacteria 2169
66 Ga0081539_10011705 3300005985 Bacteria 6889
67 Ga0070716_100207077 3300006173 Bacteria 1308
68 Ga0068871_100052826 3300006358 Bacteria 3292
69 Ga0068871_100218430 3300006358 Bacteria 1651
70 Ga0075428_100010392 3300006844 Bacteria 10334
71 Ga0075428_100454338 3300006844 Bacteria 1372
72 Ga0075431_100100033 3300006847 Bacteria 2991
73 Ga0075433_10011398 3300006852 Bacteria 7159
74 Ga0075433_10136928 3300006852 Bacteria 2177
75 Ga0075434_100078482 3300006871 Bacteria 3297
76 Ga0075434_100505724 3300006871 Bacteria 1229
77 Ga0068865_100007449 3300006881 Bacteria 6734
78 Ga0075436_100006601 3300006914 Bacteria 7950
79 Ga0075436_100034152 3300006914 Bacteria 3507
80 Ga0075436_100110372 3300006914 Bacteria 1919
81 Ga0097620_100043815 3300006931 Bacteria 4497
82 Ga0097620_100102899 3300006931 Bacteria 2914
83 Ga0097620_100224686 3300006931 Bacteria 1966
84 Ga0075435_100006213 3300007076 Bacteria 8428
85 Ga0075435_100006280 3300007076 Bacteria 8390
86 Ga0075435_100068745 3300007076 Bacteria 2886
87 Ga0075435_100075602 3300007076 Bacteria 2759
88 Ga0075435_100203751 3300007076 Bacteria 1677
89 Ga0111539_10001386 3300009094 Bacteria 32226
90 Ga0111539_10162801 3300009094 Bacteria 2609
91 Ga0111539_10181224 3300009094 Bacteria 2460
92 Ga0105245_10025490 3300009098 Bacteria 5201
93 Ga0105245_10129135 3300009098 Bacteria 2369
94 Ga0105245_10291614 3300009098 Bacteria 1598
95 Ga0105245_10301416 3300009098 Bacteria 1573
96 Ga0105247_10163969 3300009101 Bacteria 1473
97 Ga0114129_10011781 3300009147 Bacteria 12443
98 Ga0114129_10049030 3300009147 Bacteria 5936
99 Ga0114129_10287766 3300009147 Bacteria 2194
100 Ga0105242_10024472 3300009176 Bacteria 4769
101 Ga0105248_10002166 3300009177 Bacteria 21736
102 Ga0105248_10007414 3300009177 Bacteria 12038
103 Ga0105248_10031459 3300009177 Bacteria 5932
104 Ga0105248_10065317 3300009177 Bacteria 4086
105 Ga0105248_10081413 3300009177 Bacteria 3639
106 Ga0105248_10106828 3300009177 Bacteria 3156
107 Ga0105248_10125090 3300009177 Bacteria 2900
108 Ga0105249_10008340 3300009553 Bacteria 9024
109 Ga0105249_10061356 3300009553 Bacteria 3450
110 Ga0105249_10127029 3300009553 Bacteria 2429
111 Ga0105249_10384779 3300009553 Bacteria 1430
112 Ga0157374_10032471 3300013296 Bacteria 4753
113 Ga0157378_10139974 3300013297 Bacteria 2246
114 Ga0163162_10104754 3300013306 Bacteria 2923
115 Ga0163163_10040312 3300014325 Bacteria 4560
116 Ga0163163_10059206 3300014325 Bacteria 3788
117 Ga0163163_10174401 3300014325 Bacteria 2196
118 Ga0207697_10025465 3300025315 Bacteria 2418
119 Ga0207682_10018881 3300025893 Bacteria 2697
120 Ga0207642_10038969 3300025899 Bacteria 2060
121 Ga0207642_10055227 3300025899 Bacteria 1815
122 Ga0207710_10011293 3300025900 Bacteria 3760
123 Ga0207680_10012840 3300025903 Bacteria 4279
124 Ga0207680_10035809 3300025903 Bacteria 2854
125 Ga0207645_10012815 3300025907 Bacteria 5677
126 Ga0207643_10158674 3300025908 Bacteria 1360
127 Ga0207654_10041649 3300025911 Bacteria 2595
128 Ga0207654_10081497 3300025911 Bacteria 1949
129 Ga0207662_10013502 3300025918 Bacteria 4567
130 Ga0207681_10010260 3300025923 Bacteria 5735
131 Ga0207681_10018214 3300025923 Bacteria 4423
132 Ga0207650_10050030 3300025925 Bacteria 3088
133 Ga0207659_10000600 3300025926 Bacteria 21501
134 Ga0207659_10407833 3300025926 Bacteria 1138
135 Ga0207687_10098127 3300025927 Bacteria 2150
136 Ga0207700_10404283 3300025928 Bacteria 1197
137 Ga0207664_10040101 3300025929 Bacteria 3638
138 Ga0207644_10008099 3300025931 Bacteria 6882
139 Ga0207644_10114939 3300025931 Bacteria 2040
140 Ga0207644_10348281 3300025931 Bacteria 1202
141 Ga0207690_10172185 3300025932 Bacteria 1623
142 Ga0207706_10064048 3300025933 Bacteria 3237
143 Ga0207706_10105492 3300025933 Bacteria 2480
144 Ga0207706_10163357 3300025933 Bacteria 1957
145 Ga0207686_10044539 3300025934 Bacteria 2725
146 Ga0207709_10052718 3300025935 Bacteria 2500
147 Ga0207669_10137706 3300025937 Bacteria 1689
148 Ga0207704_10015262 3300025938 Bacteria 3909
149 Ga0207691_10046593 3300025940 Bacteria 3982
150 Ga0207711_10032821 3300025941 Bacteria 4391
151 Ga0207711_10047657 3300025941 Bacteria 3665
152 Ga0207711_10058729 3300025941 Bacteria 3311
153 Ga0207711_10207389 3300025941 Bacteria 1790
154 Ga0207711_10448277 3300025941 Bacteria 1201
155 Ga0207689_10125226 3300025942 Bacteria 2114
156 Ga0207661_10027924 3300025944 Bacteria 4316
157 Ga0207679_10005937 3300025945 Bacteria 7679
158 Ga0207651_10042470 3300025960 Bacteria 3026
159 Ga0207712_10039895 3300025961 Bacteria 3219
160 Ga0207668_10089885 3300025972 Bacteria 2253
161 Ga0207668_10143379 3300025972 Bacteria 1840
162 Ga0207668_10172475 3300025972 Bacteria 1698
163 Ga0207640_10008739 3300025981 Bacteria 5637
164 Ga0207658_10232386 3300025986 Bacteria 1557
165 Ga0207677_10159577 3300026023 Bacteria 1750
166 Ga0207703_10032503 3300026035 Bacteria 4130
167 Ga0207703_10051268 3300026035 Bacteria 3343
168 Ga0207703_10212989 3300026035 Bacteria 1724
169 Ga0207703_10340631 3300026035 Bacteria 1378
170 Ga0207703_10428855 3300026035 Bacteria 1232
171 Ga0207678_10078694 3300026067 Bacteria 2823
172 Ga0207678_10105951 3300026067 Bacteria 2398
173 Ga0207708_10006638 3300026075 Bacteria 8564
174 Ga0207708_10040982 3300026075 Bacteria 3532
175 Ga0207708_10306349 3300026075 Bacteria 1293
176 Ga0207641_10010351 3300026088 Bacteria 7666
177 Ga0207648_10043555 3300026089 Bacteria 3940
178 Ga0207648_10064127 3300026089 Bacteria 3202
179 Ga0207674_10030400 3300026116 Bacteria 5679
180 Ga0207675_100271131 3300026118 Bacteria 1647
181 Ga0207698_10456245 3300026142 Bacteria 1235
182 Ga0207428_10016323 3300027907 Bacteria 6389
183 Ga0268266_10031100 3300028379 Bacteria 4533
184 Ga0268266_10053712 3300028379 Bacteria 3462
185 Ga0268265_10029575 3300028380 Bacteria 3934
186 Ga0268265_10165499 3300028380 Bacteria 1884
187 Ga0307408_100072789 3300031548 Bacteria 2545
188 Ga0265314_10061350 3300031711 Bacteria 2560
189 Ga0316578_10207461 3300031728 Bacteria 1179
190 Ga0307405_10135881 3300031731 Bacteria 1707
191 Ga0307413_10207157 3300031824 Bacteria 1421
192 Ga0307410_10015570 3300031852 Bacteria 4514
193 Ga0307410_10022625 3300031852 Bacteria 3889
194 Ga0307409_100020747 3300031995 Bacteria 4486
195 Ga0307414_10096498 3300032004 Bacteria 2212
196 Ga0307414_10227678 3300032004 Bacteria 1535
197 Ga0307411_10023511 3300032005 Bacteria 3652
198 Ga0373930_0005328 3300034816 Bacteria 2134
199 Ga0373948_0003221 3300034817 Bacteria 2490
200 Ga0373950_0000445 3300034818 Bacteria 5076
201 Ga0373958_0000855 3300034819 Bacteria 3918
202 Ga0373959_0000313 3300034820 Bacteria 10059
203 Ga0373938_0000642 3300034957 Bacteria 5603
204 Ga0373929_0000316 3300035085 Bacteria 8929
205 Ga0373940_0033091 3300035088 Bacteria 1389
206 Ga0373949_0017788 3300035090 Bacteria 1605
207 Ga0373952_0000137 3300035092 Bacteria 10586
208 Ga0373932_0002400 3300035112 Bacteria 4750
209 Ga0373939_0000126 3300035114 Bacteria 22454
210 Ga0373941_0002213 3300035115 Bacteria 4246
211 Ga0373941_0067515 3300035115 Bacteria 1179
212 Ga0373960_0038213 3300035121 Bacteria 1375
213 Ga0373942_0000511 3300035207 Bacteria 10924
214 Ga0373962_0001655 3300035242 Bacteria 5297
215 Ga0373931_0013337 3300035691 Bacteria 3999
216 Ga0373937_0294543 3300036401 Bacteria 1533
217 Ga0439441_024329 3300042001 Bacteria 1137
218 Ga0439435_0052178 3300042436 Bacteria 1173
219 Ga0453684_0244682 3300044712 Bacteria 2063
220 Ga0451576_0002064 3300045051 Bacteria 31541
221 Ga0495664_0105823 3300046477 Bacteria 1696
222 Ga0495645_0007614 3300046543 Bacteria 7535
223 Ga0495636_0072539 3300047318 Bacteria 1472
224 Ga0495602_0225895 3300048088 Bacteria 1410
225 Ga0496102_0064535 3300048905 Bacteria 3354
226 Ga0496102_0265321 3300048905 Bacteria 1619
227 Ga0496104_0071871 3300048907 Bacteria 3289
228 Ga0496104_0143125 3300048907 Bacteria 2297
229 Ga0496108_0008788 3300048911 Bacteria 8190
230 Ga0496108_0037887 3300048911 Bacteria 4017
231 Ga0496108_0147683 3300048911 Bacteria 2028
232 Ga0496109_0003100 3300048912 Bacteria 13862
233 Ga0496109_0341428 3300048912 Bacteria 1414
234 Ga0496110_0001080 3300048913 Bacteria 19216
235 Ga0496111_0009504 3300048914 Bacteria 6495
236 Ga0496112_0007417 3300048915 Bacteria 9736
237 Ga0496112_0287657 3300048915 Bacteria 1590
238 Ga0496112_0488546 3300048915 Bacteria 1167
239 Ga0496113_0005194 3300048916 Bacteria 8098
240 Ga0496114_0166075 3300048917 Bacteria 1922
241 Ga0501033_0197021 3300049570 Bacteria 1440
242 Ga0501036_0065799 3300049572 Bacteria 3067
243 Ga0501036_0087311 3300049572 Bacteria 2636
244 Ga0501039_0032223 3300049575 Bacteria 4040
245 Ga0501039_0034701 3300049575 Bacteria 3892
246 Ga0501040_0194310 3300049576 Bacteria 1440
247 Ga0501041_0145231 3300049577 Bacteria 1480
248 Ga0501043_0404482 3300049579 Bacteria 1031
249 Ga0501046_0167868 3300049580 Bacteria 1648
250 Ga0501071_0002718 3300049587 Bacteria 10844
251 Ga0501071_0024345 3300049587 Bacteria 4234
252 Ga0501071_0025385 3300049587 Bacteria 4151
253 Ga0501071_0325618 3300049587 Bacteria 1167
254 Ga0501072_0034882 3300049588 Bacteria 3942
255 Ga0501072_0075359 3300049588 Bacteria 2669
256 Ga0501072_0302956 3300049588 Bacteria 1270
257 Ga0501074_0118437 3300049590 Bacteria 1894
258 Ga0501075_0029425 3300049591 Bacteria 4063
259 Ga0501075_0189525 3300049591 Bacteria 1568
260 Ga0501076_0024459 3300049592 Bacteria 4669
261 Ga0501076_0030422 3300049592 Bacteria 4205
262 Ga0501076_0037293 3300049592 Bacteria 3811
263 Ga0501076_0042126 3300049592 Bacteria 3595
264 Ga0501076_0057815 3300049592 Bacteria 3080
265 Ga0501079_0105747 3300049741 Bacteria 2184
266 Ga0501080_0143751 3300049742 Bacteria 2205
267 Ga0501080_0192174 3300049742 Bacteria 1876
268 Ga0501081_0160068 3300049743 Bacteria 1622
269 Ga0501081_0391396 3300049743 Bacteria 1028
270 Ga0501035_0082408 3300049822 Bacteria 2839
271 Ga0501045_0116336 3300049824 Bacteria 1984
272 nmdc:mga05p37_34221_c1 3300050507 Bacteria 6222
273 nmdc:mga05p37_4571_c1 3300050507 Bacteria 12442
274 nmdc:mga09592_68608_c1 3300050508 Bacteria 3007
275 nmdc:mga06r32_226648_c1 3300050510 Bacteria 1857
276 nmdc:mga08y16_219140_c1 3300050511 Bacteria 1970
277 nmdc:mga0n895_1255_c1 3300050512 Bacteria 18400
278 nmdc:mga0n895_375979_c1 3300050512 Bacteria 1438
279 nmdc:mga0rr50_1351_c1 3300050513 Bacteria 13400
280 nmdc:mga0rr50_13765_c1 3300050513 Bacteria 5280
281 nmdc:mga0rr50_13791_c1 3300050513 Bacteria 5276
282 nmdc:mga0rr50_50574_c1 3300050513 Bacteria 3080
283 nmdc:mga0rr50_55398_c1 3300050513 Bacteria 2958
284 nmdc:mga0rr50_8595_c1 3300050513 Bacteria 6363
285 nmdc:mga08x19_17566_c1 3300050514 Bacteria 4379
286 nmdc:mga08x19_7638_c1 3300050514 Bacteria 6425
287 nmdc:mga08x19_96336_c1 3300050514 Bacteria 1958
288 nmdc:mga0a205_154615_c1 3300050515 Bacteria 2192
289 Ga0495595_0049717 3300053084 Bacteria 1940
290 Ga0500658_0031332 3300053134 Bacteria 2080
291 Ga0501084_0056153 3300054114 Bacteria 3294
292 Ga0530510_0018931 3300061734 Bacteria 4883
293 Ga0070673_100105964
294 JGI25406J46586_10054776
295 Ga0065704_10115870
296 Ga0065712_10072533
297 Ga0065715_10048986
298 Ga0065715_10095372
299 Ga0065715_10133082
300 Ga0070683_100005494
301 Ga0070690_100021987
302 Ga0070670_100009020
303 Ga0070670_100024842
304 Ga0070666_10017764
305 Ga0070666_10097592
306 Ga0070691_10006554
307 Ga0070668_100162450
308 Ga0070668_100348399
309 Ga0070669_100004509
310 Ga0070675_100000325
311 Ga0070671_100007245
312 Ga0070671_100007833
313 Ga0070671_100022907
314 Ga0070671_100385058
315 Ga0070674_100013923
316 Ga0070674_100110481
317 Ga0070673_100354581
318 Ga0070688_100002711
319 Ga0070714_100019836
320 Ga0070700_100007835
321 Ga0070700_100199101
322 Ga0070694_100065523
323 Ga0070678_100125006
324 Ga0070662_100431829
325 Ga0068867_100103630
326 Ga0070699_100041767
327 Ga0070684_100000445
328 Ga0070672_100083811
329 Ga0070672_100179842
330 Ga0070686_100001255
331 Ga0070686_100064482
332 Ga0070695_100006096
333 Ga0070693_100041530
334 Ga0070693_100043910
335 Ga0070704_100091565
336 Ga0070664_100001199
337 Ga0070664_100263152
338 Ga0068857_100012578
339 Ga0068857_100116278
340 Ga0068854_100016279
341 Ga0068854_100025271
342 Ga0068854_100317039
343 Ga0070702_100174417
344 Ga0068852_100055584
345 Ga0068859_100043815
346 Ga0068859_100102901
347 Ga0068859_100224682
348 Ga0068866_10079892
349 Ga0068861_100052236
350 Ga0068861_100289545
351 Ga0068870_10147615
352 Ga0068863_100006072
353 Ga0068858_100015446
354 Ga0068860_100308410
355 Ga0068862_100017032
356 Ga0068862_100028794
357 Ga0068862_100137200
358 Ga0081539_10011705
359 Ga0070716_100207077
360 Ga0068871_100052826
361 Ga0068871_100218430
362 Ga0075428_100010392
363 Ga0075428_100454338
364 Ga0075431_100100033
365 Ga0075433_10011398
366 Ga0075433_10136928
367 Ga0075434_100078482
368 Ga0075434_100505724
369 Ga0068865_100007449
370 Ga0075436_100006601
371 Ga0075436_100034152
372 Ga0075436_100110372
373 Ga0097620_100043815
374 Ga0097620_100102899
375 Ga0097620_100224686
376 Ga0075435_100006213
377 Ga0075435_100006280
378 Ga0075435_100068745
379 Ga0075435_100075602
380 Ga0075435_100203751
381 Ga0111539_10001386
382 Ga0111539_10162801
383 Ga0111539_10181224
384 Ga0105245_10025490
385 Ga0105245_10129135
386 Ga0105245_10291614
387 Ga0105245_10301416
388 Ga0105247_10163969
389 Ga0114129_10011781
390 Ga0114129_10049030
391 Ga0114129_10287766
392 Ga0105242_10024472
393 Ga0105248_10002166
394 Ga0105248_10007414
395 Ga0105248_10031459
396 Ga0105248_10065317
397 Ga0105248_10081413
398 Ga0105248_10106828
399 Ga0105248_10125090
400 Ga0105249_10008340
401 Ga0105249_10061356
402 Ga0105249_10127029
403 Ga0105249_10384779
404 Ga0157374_10032471
405 Ga0157378_10139974
406 Ga0163162_10104754
407 Ga0163163_10040312
408 Ga0163163_10059206
409 Ga0163163_10174401
410 Ga0207697_10025465
411 Ga0207682_10018881
412 Ga0207642_10038969
413 Ga0207642_10055227
414 Ga0207710_10011293
415 Ga0207680_10012840
416 Ga0207680_10035809
417 Ga0207645_10012815
418 Ga0207643_10158674
419 Ga0207654_10041649
420 Ga0207654_10081497
421 Ga0207662_10013502
422 Ga0207681_10010260
423 Ga0207681_10018214
424 Ga0207650_10050030
425 Ga0207659_10000600
426 Ga0207659_10407833
427 Ga0207687_10098127
428 Ga0207700_10404283
429 Ga0207664_10040101
430 Ga0207644_10008099
431 Ga0207644_10114939
432 Ga0207644_10348281
433 Ga0207690_10172185
434 Ga0207706_10064048
435 Ga0207706_10105492
436 Ga0207706_10163357
437 Ga0207686_10044539
438 Ga0207709_10052718
439 Ga0207669_10137706
440 Ga0207704_10015262
441 Ga0207691_10046593
442 Ga0207711_10032821
443 Ga0207711_10047657
444 Ga0207711_10058729
445 Ga0207711_10207389
446 Ga0207711_10448277
447 Ga0207689_10125226
448 Ga0207661_10027924
449 Ga0207679_10005937
450 Ga0207651_10042470
451 Ga0207712_10039895
452 Ga0207668_10089885
453 Ga0207668_10143379
454 Ga0207668_10172475
455 Ga0207640_10008739
456 Ga0207658_10232386
457 Ga0207677_10159577
458 Ga0207703_10032503
459 Ga0207703_10051268
460 Ga0207703_10212989
461 Ga0207703_10340631
462 Ga0207703_10428855
463 Ga0207678_10078694
464 Ga0207678_10105951
465 Ga0207708_10006638
466 Ga0207708_10040982
467 Ga0207708_10306349
468 Ga0207641_10010351
469 Ga0207648_10043555
470 Ga0207648_10064127
471 Ga0207674_10030400
472 Ga0207675_100271131
473 Ga0207698_10456245
474 Ga0207428_10016323
475 Ga0268266_10031100
476 Ga0268266_10053712
477 Ga0268265_10029575
478 Ga0268265_10165499
479 Ga0307408_100072789
480 Ga0265314_10061350
481 Ga0316578_10207461
482 Ga0307405_10135881
483 Ga0307413_10207157
484 Ga0307410_10015570
485 Ga0307410_10022625
486 Ga0307409_100020747
487 Ga0307414_10096498
488 Ga0307414_10227678
489 Ga0307411_10023511
490 Ga0373930_0005328
491 Ga0373948_0003221
492 Ga0373950_0000445
493 Ga0373958_0000855
494 Ga0373959_0000313
495 Ga0373938_0000642
496 Ga0373929_0000316
497 Ga0373940_0033091
498 Ga0373949_0017788
499 Ga0373952_0000137
500 Ga0373932_0002400
501 Ga0373939_0000126
502 Ga0373941_0002213
503 Ga0373941_0067515
504 Ga0373960_0038213
505 Ga0373942_0000511
506 Ga0373962_0001655
507 Ga0373931_0013337
508 Ga0373937_0294543
509 Ga0439441_024329
510 Ga0439435_0052178
511 Ga0453684_0244682
512 Ga0451576_0002064
513 Ga0495664_0105823
514 Ga0495645_0007614
515 Ga0495636_0072539
516 Ga0495602_0225895
517 Ga0496102_0064535
518 Ga0496102_0265321
519 Ga0496104_0071871
520 Ga0496104_0143125
521 Ga0496108_0008788
522 Ga0496108_0037887
523 Ga0496108_0147683
524 Ga0496109_0003100
525 Ga0496109_0341428
526 Ga0496110_0001080
527 Ga0496111_0009504
528 Ga0496112_0007417
529 Ga0496112_0287657
530 Ga0496112_0488546
531 Ga0496113_0005194
532 Ga0496114_0166075
533 Ga0501033_0197021
534 Ga0501036_0065799
535 Ga0501036_0087311
536 Ga0501039_0032223
537 Ga0501039_0034701
538 Ga0501040_0194310
539 Ga0501041_0145231
540 Ga0501043_0404482
541 Ga0501046_0167868
542 Ga0501071_0002718
543 Ga0501071_0024345
544 Ga0501071_0025385
545 Ga0501071_0325618
546 Ga0501072_0034882
547 Ga0501072_0075359
548 Ga0501072_0302956
549 Ga0501074_0118437
550 Ga0501075_0029425
551 Ga0501075_0189525
552 Ga0501076_0024459
553 Ga0501076_0030422
554 Ga0501076_0037293
555 Ga0501076_0042126
556 Ga0501076_0057815
557 Ga0501079_0105747
558 Ga0501080_0143751
559 Ga0501080_0192174
560 Ga0501081_0160068
561 Ga0501081_0391396
562 Ga0501035_0082408
563 Ga0501045_0116336
564 nmdc:mga05p37_34221_c1
565 nmdc:mga05p37_4571_c1
566 nmdc:mga09592_68608_c1
567 nmdc:mga06r32_226648_c1
568 nmdc:mga08y16_219140_c1
569 nmdc:mga0n895_1255_c1
570 nmdc:mga0n895_375979_c1
571 nmdc:mga0rr50_1351_c1
572 nmdc:mga0rr50_13765_c1
573 nmdc:mga0rr50_13791_c1
574 nmdc:mga0rr50_50574_c1
575 nmdc:mga0rr50_55398_c1
576 nmdc:mga0rr50_8595_c1
577 nmdc:mga08x19_17566_c1
578 nmdc:mga08x19_7638_c1
579 nmdc:mga08x19_96336_c1
580 nmdc:mga0a205_154615_c1
581 Ga0495595_0049717
582 Ga0500658_0031332
583 Ga0501084_0056153
584 Ga0530510_0018931

MSA Aligner

Download Fasta Download Aligned Fasta

Family Sequences

Functional Annotation

PFAM ID Name Description Start Position End Position Accuracy

PF00158

Sigma54_activat

Sigma-54 interaction domain

10

177

0.99

PF02954

HTH_8

Bacterial regulatory protein, Fis family

326

366

0.95

PF14532

Sigma54_activ_2

Sigma-54 interaction domain

11

181

0.87

PF07728

AAA_5

AAA domain (dynein-related subfamily)

33

161

0.75

Structural Annotation

Top 5 Hits

ID Description Score Start End
4fis-assembly1.cif.gz_A the molecular structure of wild-type and a mutant fis protein: relationship between mutational changes and recombinational enhancer function or dna binding 0.9733 272 313
3dzd-assembly1.cif.gz_B crystal structure of sigma54 activator ntrc4 in the inactive state 0.9695 12 250
5ds9-assembly1.cif.gz_A crystal structure of fis bound to 27bp dna f1-8a (aaattagtttgaattttgagctaattt) 0.9612 272 315
1etq-assembly2.cif.gz_C the crystal structure of e. coli fis mutant r71y 0.9592 268 315
2m8g-assembly1.cif.gz_X structure, function, and tethering of dna-binding domains in 54 transcriptional activators 0.9589 270 313
ID Description Score Start End Superfamily
5m7nA02 Alpha Beta;3-Layer(aba) Sandwich;Rossmann fold;P-loop containing nucleotide triphosphate hydrolases 0.9737 12 180 3.40.50.300
4fisA00 Mainly Alpha;Orthogonal Bundle;Arc Repressor Mutant, subunit A;Homeodomain-like 0.9733 272 313 1.10.10.60
1ojlB01 Alpha Beta;3-Layer(aba) Sandwich;Rossmann fold;P-loop containing nucleotide triphosphate hydrolases 0.9657 13 182 3.40.50.300
af_P07604_193_369_3.40.50.300 Alpha Beta;3-Layer(aba) Sandwich;Rossmann fold;P-loop containing nucleotide triphosphate hydrolases 0.9656 13 183 3.40.50.300
1fipA00 Mainly Alpha;Orthogonal Bundle;Arc Repressor Mutant, subunit A;Homeodomain-like 0.9614 268 315 1.10.10.60
ID Description Score Start End GO Terms
AF-A0A1E7IKM2-F1-model_v4 Sigma-54-dependent Fis family transcriptional regulator 0.9818 15 185 GO:0000160
GO:0005524
GO:0006355
GO:0016887
AF-A0A2V2L325-F1-model_v4 deleted 0.9818 41 146
AF-A0A356TIY6-F1-model_v4 Two-component system response regulator 0.9817 42 156 GO:0005524
GO:0006355
AF-A0A7Y5G1B4-F1-model_v4 Sigma-54-dependent Fis family transcriptional regulator 0.9811 13 164 GO:0000160
GO:0005524
GO:0006355
GO:0016887
AF-A0A356P6C2-F1-model_v4 Sigma-54-dependent Fis family transcriptional regulator 0.9802 13 185 GO:0003677
GO:0005524
GO:0006355
GO:0016887

Map